Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081I23

Clone ID RBdS081I23
HP ID HP00576
Gene ID 6157
Gene Symbol RPL27A
Protein Name ribosomal protein L27a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000990.4
Length of RefSeq (bp) 4906
Chromosome 11p15
Reference DDBJ accession
UniGene Hs.523463
5'-terminal sequence GCTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
2011.08.28