Prev. |  KEGG KO K02900 > 

RIKEN DNA Bank Human Resource - RPL27A

Gene ID NCBI Gene 6157 |  KEGG hsa:6157
Gene Symbol RPL27A
Protein Name ribosomal protein L27a
Synonyms L27A
Ortholog resources KEGG ortholog (KEGG orthology K02900) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006018 IRAK015A18 pCMV-SPORT6 BC014919
HGY067386 IRAK168H18 pBluescriptR BC066326 NM_000990
HGY085473 IRAL013L09 pOTB7 BC004284
HGY086444 IRAL016B20 pDNR-LIB BC005326 NM_000990 Full
HGY089467 IRAL023L03 pOTB7 BC020169 NM_000990 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082809 M01C007A09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE082857 M01C007C09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE082905 M01C007E09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE082953 M01C007G09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE083001 M01C007I09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE083049 M01C007K09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE083097 M01C007M09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  
HGE083145 M01C007O09 pDONR221 FLJ01-A05 AK125453 ENST00000356931  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042126 ARe05F06 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCTTTTTCCACACAGCCATCCAGACTGAGGAAGAC
HKR046527 ARe16F07 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR046826 ARe17B02 pKA1U5 NM_000990.4  
GCTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR050409 ARe26A09 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR050952 ARe27G08 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR051212 ARe28A12 pKA1U5 NM_000990.4  
TGCTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR051753 ARe29G09 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR054554 ARe36G10 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR054883 ARe37D11 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR055209 ARe38A09 pKA1U5 NM_000990.4  
TGGCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR056105 ARe40E09 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR064081 ARe60D09 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR066529 ARe66F09 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR066580 ARe66H12 pKA1U5 NM_000990.4  
GGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGGGCCACGT
HKR072831 ARe82B07 pKA1U5 NM_000990.4  
GCTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR076923 ARe92F03 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR078100 ARe95E04 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR078578 ARe96H10 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR079284 ARe98D12 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR080499 ARf01E03 pKA1U5 NM_000990.4  
TGCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR081356 ARf03G12 pKA1U5 NM_000990.4  
GGGCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR082025 ARf05B01 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR160523 ARi01F03 pGCAP10 NM_000990.4  
HKR161697 ARi04E01 pGCAP10 NM_000990.4  
GCCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR165225 ARi13B01 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR167776 ARi19H08 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR170949 ARi27G05 pGCAP10 NM_000990.4  
TTTTTTTTTTTTTTTTTTTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGA
HKR172906 ARi32E10 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR174100 ARi35E04 pGCAP10 NM_000990.4  
TGCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR174901 ARi37E05 pGCAP10 NM_000990.4  
GGCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR175210 ARi38A10 pGCAP10 NM_000990.4  
GCTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR175305 ARi38E09 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR176076 ARi40D04 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR176473 ARi41D01 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR176923 ARi42F03 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR180978 ARi52H10 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR182804 ARi57A04 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR183349 ARi58G05 pGCAP10 NM_000990.4  
GCTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR187282 ARi68D10 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR188107 ARi70E11 pGCAP10 NM_000990.4  
GTGCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR205575 ARiS013P15 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR209417 ARiS023J01 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR218051 ARiS045C03 pGCAP10 NM_000990.4  
GCTTTTTCGTCNGGGCNGCCAACANGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR219636 ARiS049B12 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR222209 ARiS055I17 pGCAP10 NM_000990.4  
GCTTTTTCNTCTGGG?TGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR222360 ARiS055O24 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR234974 ARiS087H06 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR235546 ARiS088O10 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR238755 ARiS096O19 pGCAP10 NM_000990.4  
GGTCTGGNCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGGGCCACGT
HKR260151 ARiS150G07 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR260233 ARiS150J17 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR260261 ARiS150K21 pGCAP10 NM_000990.4  
GNTTTTTCGTCTGGGCTGCCAACNTGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR264550 ARiS161G06 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR276488 ARiS191D16 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR276567 ARiS191G23 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR276730 ARiS191N18 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR279255 ARiS198C07 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR323612 RBb09A12 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR327260 RBb18C12 pKA1U5 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR331371 RBb28H03 pGCAP1 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR339380 RBb48H12 pGCAP1 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR341209 RBb53A09 pGCAP1 NM_000990.4  
GCTTTTTTCGNTCATGGGCNTGCCAACATGCCATCCAGNACTGTANGCAAGACCCGGAAA
HKR342503 RBb56E07 pGCAP1 NM_000990.4  
GCTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGG
HKR344003 RBb60A03 pGCAP1 NM_000990.4  
AAATGTGTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAAC
HKR368152 RBd20G08 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR369273 RBd23D01 pGCAP10 NM_000990.4  
GGCCGATACCTCGCGAGACTTGGCGAAGGCCTTCCTTTTTCGTCTGGGCTGCCAACATGC
HKR370899 RBd27E03 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR374545 RBd36G01 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR378151 RBd45G07 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR382579 RBd56H11 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAANNNNCGGAAACTTAGGG
HKR384082 RBd60D10 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR385277 RBd63D05 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR386055 RBd65C07 pGCAP10 NM_000990.4  
GCTTTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTT
HKR388548 RBd71G04 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR392812 RBd82A12 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR395700 RBd89E04 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR396873 RBd92D01 pGCAP10 NM_000990.4  
GCTTTTTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAAC
HKR397210 RBd93A10 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR397608 RBd94A08 pGCAP10 NM_000990.4  
GCTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR399231 RBd98B07 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR416083 RBdS040D11 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR432615 RBdS081I23 pGCAP10 NM_000990.4  
GCTTTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAG
HKR452889 RBdS132D17 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR461841 RBdS154K01 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG
HKR474947 RBdS187G03 pGCAP10 NM_000990.4  
GCTTTTTCGTCTGGGCTGCCAACATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl