Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081F12

Clone ID RBdS081F12
HP ID HP04338
Gene ID 5908
Gene Symbol RAP1B
Protein Name RAP1B, member of RAS oncogene family
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015646.4
Length of RefSeq (bp) 2126
Chromosome 12q14
Reference DDBJ accession
UniGene Hs.369920
5'-terminal sequence GAAACCTCGCCCAGATTCAGGCGTGTAAACCAGCCGGAGCGGCGCGGCAGCGGCAGGACC
2011.08.28