Prev. |  KEGG KO K07836 > 

RIKEN DNA Bank Human Resource - RAP1B

Gene ID NCBI Gene 5908 |  KEGG hsa:5908
Gene Symbol RAP1B
Protein Name RAP1B, member of RAS oncogene family
Synonyms K-REV|RAL1B
Ortholog resource in our bank

  RAP1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069734 IRAK174F14 pCMV-SPORT6 BC078173 NM_015646 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279531 ARiS198N19 pGCAP10 NM_015646.4  
GGGCAGGACCGCCGTGGCGCCTAGAGTAGCGACCCGGGGGGAGCGCGGGGCGACGCTGGC
HKR383305 RBd58E09 pGCAP10 NM_015646.4  
GAGGCGTGTAAACCAGCCGGAGCGGCGCGGCAGCGGCAGGACCGCCGTGGCGCCTAGAGT
HKR432532 RBdS081F12 pGCAP10 NM_015646.4  
GAAACCTCGCCCAGATTCAGGCGTGTAAACCAGCCGGAGCGGCGCGGCAGCGGCAGGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl