Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081D04

Clone ID RBdS081D04
HP ID HP00408
Gene ID 5861
Gene Symbol RAB1A
Protein Name RAB1A, member RAS oncogene family
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004161.4
Length of RefSeq (bp) 2648
Chromosome 2p14
Reference DDBJ accession
UniGene Hs.310645
5'-terminal sequence TGGATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGC
2011.08.28