Prev. |  KEGG KO K07874 > 

RIKEN DNA Bank Human Resource - RAB1A

Gene ID NCBI Gene 5861 |  KEGG hsa:5861
Gene Symbol RAB1A
Protein Name RAB1A, member RAS oncogene family
Synonyms RAB1|YPT1
Featured content Rab Family - human
Ortholog resource in our bank

  RAB1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19287 pCMV-RAB1 Expression vector of human RAB1A-P2A-moxGFP under the control of CMV promoter.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001461 IRAK003K21 pCMV-SPORT6 BC000905 NM_004161 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021451 W01A053K11 pENTR-TOPO IRAK003K21 BC000905 NM_004161  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR160526 ARi01F06 pGCAP10 NM_004161.4  
TGATTTTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGG
HKR174850 ARi37C02 pGCAP10 NM_004161.4  
GATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGG
HKR183699 ARi59E03 pGCAP10 NM_004161.4  
GGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGAGTANGGGA
HKR219969 ARiS049P09 pGCAP10 NM_004161.4  
GGTGNAANCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGANTAGGG
HKR322478 RBb06D06 pKA1U5 NM_004161.4  
GCCTGGTTCGCCGGCGGCCATTTTGGGTGGAANCGATAGCTGAGTGGCGGCGGCTGCTGA
HKR325373 RBb13H05 pKA1U5 NM_004161.4  
TTGATTTTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGG
HKR432476 RBdS081D04 pGCAP10 NM_004161.4  
TGGATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl