Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081C01

Clone ID RBdS081C01
HP ID HP00310
Gene ID 6144
Gene Symbol RPL21
Protein Name ribosomal protein L21
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000982.3
Length of RefSeq (bp) 582
Chromosome 13q12.2
Reference DDBJ accession
UniGene Hs.381123
5'-terminal sequence GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
2011.08.28