Prev. |  KEGG KO K02889 > 

RIKEN DNA Bank Human Resource - RPL21

Gene ID NCBI Gene 6144 |  KEGG hsa:6144
Gene Symbol RPL21
Protein Name ribosomal protein L21
Synonyms HYPT12|L21
Ortholog resources KEGG ortholog (KEGG orthology K02889) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083218 IRAL008A18 pOTB7 BC001603 NM_000982 Full
HGY084338 IRAL010O02 pOTB7 BC007505 NM_000982 Full
HGY100256 IRAL050K16 pOTB7 BC062981 NM_000982 Full
HGY102808 IRAL057A08 pDNR-LIB BC070330 NM_000982 Full
HGY102836 IRAL057B12 pDNR-LIB BC070323 NM_000982 Full
HGY102850 IRAL057C02 pDNR-LIB BC070184 NM_000982 Full
HGY103314 IRAL058E18 pOTB7 BC071902 NM_000982 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040932 ARe02F12 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR041351 ARe03G07 pKA1U5 NM_000982.3  
TGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR043708 ARe09E12 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR046977 ARe17H09 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR048173 ARe20H05 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR049300 ARe23E04 pKA1U5 NM_000982.3  
GCCTTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR050528 ARe26F08 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR051299 ARe28E03 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR051349 ARe28G05 pKA1U5 NM_000982.3  
TGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR053236 ARe33B12 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR053258 ARe33C10 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR055348 ARe38G04 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATCTCGNCAAAATGACGAACACAAAGGGA
HKR058975 ARe47H07 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATNCNTCAAAATGACGAACACAAAGGGAA
HKR060034 ARe50B10 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR060403 ARe51A03 pKA1U5 NM_000982.3  
TGCCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGG
HKR063673 ARe59D01 pKA1U5 NM_000982.3  
GCCTTCCTTTCGGCCGGAACCGCCATCTTCCAGCTAATTCGCCAAAATGACGAACACAAA
HKR063681 ARe59D09 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR063682 ARe59D10 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR068477 ARe71D05 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR070074 ARe75D02 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATNCGCCAAAATGACGAACACAAAGGGAA
HKR070806 ARe77A06 pKA1U5 NM_000982.3  
TCCTTTCGGCCGGAACCGCCATCTTCCAGTAATNCGNCAAAATGACGAACACAAAGGGAA
HKR072473 ARe81D01 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR072972 ARe82H04 pKA1U5 NM_000982.3  
GCCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR073328 ARe83F08 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR073698 ARe84E02 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR074479 ARe86D07 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR079633 ARe99B09 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR080483 ARf01D11 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGNCAAAATGACGAACACAAAGGGAA
HKR080549 ARf01G05 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR081628 ARf04B04 pKA1U5 NM_000982.3  
TGCCTTTCGGCCGGAACCGCCATCTTCCAGGTAATTCGCCAAAATGACGAACACAAAGGG
HKR160450 ARi01C02 pGCAP10 NM_000982.3  
GCCTTTCGGAGAAACAGGGGAAATTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR167258 ARi18C10 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR167680 ARi19D08 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR171251 ARi28C03 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR171276 ARi28D04 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR171653 ARi29C05 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR171700 ARi29E04 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR172576 ARi31H08 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR176059 ARi40C11 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR178451 ARi46C03 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR178527 ARi46F07 pGCAP10 NM_000982.3  
GGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAAAGAGGAGAGG
HKR178952 ARi47G08 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR179225 ARi48B01 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR180004 ARi50A04 pGCAP10 NM_000982.3  
TGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR180430 ARi51B06 pGCAP10 NM_000982.3  
CGGCCGGCCGATGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGA
HKR182052 ARi55C04 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR182852 ARi57C04 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR184551 ARi61G07 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR184879 ARi62D07 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR185730 ARi64F10 pGCAP10 NM_000982.3  
HKR203375 ARiS008H07 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR203497 ARiS008M09 pGCAP10 NM_000982.3  
GCCTTTCCTTTCNGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAA
HKR203542 ARiS008O06 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR209291 ARiS023D19 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR218123 ARiS045F03 pGCAP10 NM_000982.3  
GCCTTTTCNGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR222006 ARiS055A06 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR222023 ARiS055A23 pGCAP10 NM_000982.3  
HKR222331 ARiS055N19 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR234942 ARiS087F22 pGCAP10 NM_000982.3  
CNCCAAAATGACNAACACNAAGGGAAANAGGANAGGCACCCGATATATGTTCTCTAGGCCT
HKR234953 ARiS087G09 pGCAP10 NM_000982.3  
GCCTTGAAGGCCCCTTTCCGGGCTGTCTGACACGATGCAAGTGTCAGCTTGTGTTGGCCG
HKR235096 ARiS087M08 pGCAP10 NM_000982.3  
GCCTTTTCGGCCGGAACCGCCATCTTCCAGGGAATGGGTACTGTTCAAAAAGGAATGCCC
HKR235146 ARiS087O10 pGCAP10 NM_000982.3  
GTCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR238475 ARiS096D03 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR238532 ARiS096F12 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR260137 ARiS150F17 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR260192 ARiS150H24 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR276406 ARiS191A06 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR277917 ARiS194N05 pGCAP10 NM_000982.3  
GGCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR279358 ARiS198G14 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR279492 ARiS198M04 pGCAP10 NM_000982.3  
CATGGCATAATNNGTGTTAAAAAAAAAAATAAANGACCTCTGGGCTANNNNNAANANAAA
HKR321208 RBb03A08 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR322976 RBb07H08 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGNCAAAATGACGAACACAAAGGGAA
HKR323351 RBb08G07 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR323747 RBb09G03 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR324459 RBb11C11 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR326972 RBb17H04 pKA1U5 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR329658 RBb24C10 pGCAP1 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR330173 RBb25H05 pGCAP1 NM_000982.3  
TTGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGG
HKR330572 RBb26H04 pGCAP1 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR337636 RBb44B12 pGCAP1 NM_000982.3  
TTGATGCCTTTCGCGCCGGAACCGCCATCTTCCAGGTAATTCGCCANANTGACGAACA
HKR338402 RBb46A02 pGCAP1 NM_000982.3  
TTGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGG
HKR339321 RBb48F01 pGCAP1 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR339726 RBb49F06 pGCAP1 NM_000982.3  
TGGGTTTCCTTTCGGCCGGAACCGCCATCTTCCAGNTAATTCCCCTAAATGACGAACACA
HKR342902 RBb57E06 pGCAP1 NM_000982.3  
GCCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR343660 RBb59C12 pGCAP1 NM_000982.3  
CCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAAA
HKR344454 RBb61C06 pGCAP1 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR345627 RBb64B03 pGCAP1 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR348831 RBb72B07 pGCAP1 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR360430 RBd01B06 pGCAP10 NM_000982.3  
TAGCCTTTCCCGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGG
HKR360811 RBd02A11 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR361732 RBd04F12 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR363625 RBd09B01 pGCAP10 NM_000982.3  
GGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAAAGAGGA
HKR364124 RBd10F04 pGCAP10 NM_000982.3  
CGGCCGGCCGATTAGCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGAC
HKR365300 RBd13E04 pGCAP10 NM_000982.3  
GTTTCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGG
HKR366851 RBd17C03 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR369654 RBd24C06 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR374003 RBd35A03 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR374454 RBd36C06 pGCAP10 NM_000982.3  
GGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAAAGAGGA
HKR377658 RBd44C10 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR379274 RBd48D02 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR380453 RBd51C05 pGCAP10 NM_000982.3  
GTTTCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGG
HKR381302 RBd53E06 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGANNAACACAAAGGGAA
HKR382833 RBd57B09 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACNAACACAAAGGGAA
HKR384103 RBd60E07 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR388128 RBd70F08 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR393233 RBd83B09 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR393308 RBd83E12 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR396106 RBd90E10 pGCAP10 NM_000982.3  
GCCTTCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAG
HKR396432 RBd91B08 pGCAP10 NM_000982.3  
GCCTTTTTTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAA
HKR396852 RBd92C04 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR405871 RBdS014L07 pGCAP10 NM_000982.3  
GCCTTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR406206 RBdS015I14 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR409144 RBdS022O08 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCANTAATTCNCCAAAATGACNAANNCNNAGGGAA
HKR409162 RBdS022P02 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR420433 RBdS051B09 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR430251 RBdS075K11 pGCAP10 NM_000982.3  
GCCCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGG
HKR432449 RBdS081C01 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR432705 RBdS081M17 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR444297 RBdS110M09 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR444384 RBdS110P24 pGCAP10 NM_000982.3  
GCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAAA
HKR453165 RBdS132P05 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR461914 RBdS154N02 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
HKR474900 RBdS187E04 pGCAP10 NM_000982.3  
GTCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGA
HKR475162 RBdS187P02 pGCAP10 NM_000982.3  
GCCTTTCGGCCGGAACCGCCATCTTCCAGTAATTCGCCAAAATGACGAACACAAAGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl