Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075C20

Clone ID RBdS075C20
HP ID HP00149
Gene ID 6139
Gene Symbol RPL17
Protein Name ribosomal protein L17
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000985.3
Length of RefSeq (bp) 942
Chromosome 18q21
Reference DDBJ accession
UniGene Hs.374588
5'-terminal sequence GCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCC
2011.08.28