Prev. |  KEGG KO K02880 > 

RIKEN DNA Bank Human Resource - RPL17

Gene ID NCBI Gene 6139 |  KEGG hsa:6139
Gene Symbol RPL17
Protein Name ribosomal protein L17
Synonyms L17|PD-1|RPL23
Ortholog resources KEGG ortholog (KEGG orthology K02880) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066865 IRAK167C17 pBluescriptR BC066323 NM_001035006 Full
HGY066868 IRAK167C20 pBluescriptR BC066324 NM_001035006 Full/var
HGY080536 IRAL001F16 pOTB7 BC000502 NM_001035006 Full
HGY094142 IRAL035F22 pDNR-LIB BC017831 NM_001035006 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE026886 W01A067D14 pENTR-TOPO IRAK167C17 BC066323 NM_001035006  
HGE026896 W01A067D24 pENTR-TOPO IRAK167C17 BC066323 NM_001035006  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044055 ARe10C07 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR046949 ARe17G05 pKA1U5 NM_000985.3  
GCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAAC
HKR046976 ARe17H08 pKA1U5 NM_000985.3  
CCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR047603 ARe19A03 pKA1U5 NM_000985.3  
GCTCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR047674 ARe19D02 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR052927 ARe32F07 pKA1U5 NM_000985.3  
GTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR053375 ARe33H07 pKA1U5 NM_000985.3  
ATCCTGGCTCTTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCA
HKR057697 ARe44E01 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR064035 ARe60B11 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR064503 ARe61E07 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGCNANTGGTTCGCTATTCACTTGACCCG
HKR068904 ARe72E08 pKA1U5 NM_000985.3  
ATCCTGGCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACT
HKR071779 ARe79H11 pKA1U5 NM_000985.3  
TGCTCTCTCTCTTTCCCTAAGCAGCCTGAGGGTTGACTGGATTGGTGAGGCCCGTGTGGC
HKR076578 ARe91H10 pKA1U5 NM_000985.3  
ATCCTGCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTG
HKR077371 ARe93H03 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR078050 ARe95C02 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR080405 ARf01A05 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR082481 ARf06D09 pKA1U5 NM_000985.3  
GCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCC
HKR162473 ARi06D01 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR162551 ARi06G07 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGGTTGACTGGATTGGTGAGGCCCGTGTGGCTACTTCT
HKR163678 ARi09D06 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR166425 ARi16B01 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR169233 ARi23B09 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR170576 ARi26H08 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR172108 ARi30E12 pGCAP10 NM_000985.3  
GGTTTTCTCCTGCGTTGCTCCGAGGGCCCAATCCTCCTGCCATCGCCGCCATCCTGGCTT
HKR172484 ARi31D12 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR172831 ARi32B07 pGCAP10 NM_000985.3  
GGTTTCTCCTGCGTTGCTCCGAGGGCCCAATCCTCCTGCCATCGCCGCCATCCTGGCTTC
HKR173704 ARi34E08 pGCAP10 NM_000985.3  
GTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR174578 ARi36H10 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR176125 ARi40F05 pGCAP10 NM_000985.3  
GGGGCCCAATCCTCCTGCCATCGCCGCCATCCTGGCTTCGGGGGCGCCGGCCTCCAGGCC
HKR178005 ARi45A05 pGCAP10 NM_000985.3  
GCTCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR180809 ARi52A09 pGCAP10 NM_000985.3  
GCTCTTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTT
HKR181609 ARi54A09 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR182084 ARi55D12 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR183612 ARi59A12 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR184054 ARi60C06 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR203393 ARiS008I01 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR208209 ARiS020I17 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR234181 ARiS085H13 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR234935 ARiS087F15 pGCAP10 NM_000985.3  
GCTCTCTTTCCCTAAGCANCCTGANGGTTGACTGGATTGGTGAGGCCCGTGTGGCTACTT
HKR235114 ARiS087N02 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR243671 ARiS109C23 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR247399 ARiS118I07 pGCAP10 NM_000985.3  
CTCTTTCCCTAAGCAGCCTNNNGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGG
HKR248938 ARiS122F18 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR248971 ARiS122H03 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR277739 ARiS194F19 pGCAP10 NM_000985.3  
CTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGG
HKR279222 ARiS198A22 pGCAP10 NM_000985.3  
HKR279432 ARiS198J16 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR325707 RBb14E11 pKA1U5 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGGTTGACTGGATTGGTGAGGCCCGTGNTGGCTACTTC
HKR326099 RBb15E03 pKA1U5 NM_000985.3  
GCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAANATGGTTCGCTATTCACTTGACCC
HKR330828 RBb27B04 pGCAP1 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGCTTCNCATATTCACTTGACC
HKR332432 RBb31B08 pGCAP1 NM_000985.3  
HKR333379 RBb33H11 pGCAP1 NM_000985.3  
ACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTTCACTTTTAAGAACACTCGTG
HKR338029 RBb45B05 pGCAP1 NM_000985.3  
TGGTCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGAC
HKR338454 RBb46C06 pGCAP1 NM_000985.3  
GAGTTCTCCCAAAATCCACCGCTCTTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGA
HKR348434 RBb71B10 pGCAP1 NM_000985.3  
GCTCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR364405 RBd11A05 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR364522 RBd11F02 pGCAP10 NM_000985.3  
GCTCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR364955 RBd12G11 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGANAATGGTTCGCTATTCACTTGACCCG
HKR365307 RBd13E11 pGCAP10 NM_000985.3  
GCTTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGA
HKR368478 RBd21D06 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR373226 RBd33B02 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR376425 RBd41B01 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTNNNGNNATCTNNNAAAATGGTTCGCTATTCACTTGACCCG
HKR384011 RBd60A11 pGCAP10 NM_000985.3  
GGTCTTTCCCTAAACGTGCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACGTGACCCG
HKR384036 RBd60B12 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR390499 RBd76E03 pGCAP10 NM_000985.3  
CCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR392556 RBd81G12 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR395779 RBd89H11 pGCAP10 NM_000985.3  
ACGCCTCTTTCCCTAAGCAGCCTGAGGCTGTATTTTCTTCCAAAGGGTTGACTGGATTGG
HKR397723 RBd94F03 pGCAP10 NM_000985.3  
CGGCCGGCCGATGCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTAT
HKR398954 RBd97G10 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR402886 RBdS007D14 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR405830 RBdS014J14 pGCAP10 NM_000985.3  
CTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGG
HKR409000 RBdS022I08 pGCAP10 NM_000985.3  
GTCTTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTG
HKR428119 RBdS070E23 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR430068 RBdS075C20 pGCAP10 NM_000985.3  
GCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCC
HKR432536 RBdS081F16 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR442107 RBdS105E11 pGCAP10 NM_000985.3  
GCTCTTCCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTT
HKR453078 RBdS132L14 pGCAP10 NM_000985.3  
GCTCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACC
HKR461627 RBdS154B03 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG
HKR470920 RBdS177E24 pGCAP10 NM_000985.3  
GCTCTTTCCCTAAGCAGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl