Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070M22

Clone ID RBdS070M22
HP ID HP07811
Gene ID 6241
Gene Symbol RRM2
Protein Name ribonucleotide reductase M2 polypeptide
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001034.1
Length of RefSeq (bp) 2500
Chromosome 2p25-p24
Reference DDBJ accession
UniGene Hs.226390
5'-terminal sequence GGTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCGCCAC
2011.08.28