Prev. |  KEGG KO K10808 > 

RIKEN DNA Bank Human Resource - RRM2

Gene ID NCBI Gene 6241 |  KEGG hsa:6241
Gene Symbol RRM2
Protein Name ribonucleotide reductase regulatory subunit M2
Synonyms C2orf48|R2|RR2|RR2M
Ortholog resource in our bank

  RRM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020978 IRAK052H10 pCMV-SPORT6 BC028932 NM_001034 Partial
HGY083447 IRAL008K07 pOTB7 BC001886 NM_001034 Full
HGY095768 IRAL039G24 pOTB7 BC030154 NM_001034 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374031 RBd35B07 pGCAP10 NM_001034.1  
GGTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCGCCAC
HKR377651 RBd44C03 pGCAP10 NM_001034.1  
GGTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCGCCAC
HKR395327 RBd88F07 pGCAP10 NM_001034.1  
GGCCCGTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCG
HKR428310 RBdS070M22 pGCAP10 NM_001034.1  
GGTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl