Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070J17

Clone ID RBdS070J17
HP ID HP00017
Gene ID 6146
Gene Symbol RPL22
Protein Name ribosomal protein L22
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000983.3
Length of RefSeq (bp) 2099
Chromosome 1p36.3-p36.2, D217_TRIGR(82.8%/87aa),RL31_YEAST(38.8%/49aa)
Reference DDBJ accession
UniGene Hs.515329
5'-terminal sequence GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
2011.08.28