Prev. |  KEGG KO K02891 > 

RIKEN DNA Bank Human Resource - RPL22

Gene ID NCBI Gene 6146 |  KEGG hsa:6146
Gene Symbol RPL22
Protein Name ribosomal protein L22
Synonyms EAP|HBP15|HBP15/L22|L22
Ortholog resources KEGG ortholog (KEGG orthology K02891) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025611 IRAK064A11 pCMV-SPORT6 BC032295 NM_000983 Partial/var
HGX025694 IRAK064D22 pCMV-SPORT6 BC035566 NM_000983 Full
HGX047882 IRAK119L18 pCMV-SPORT6 BC058887 NM_000983 Full
HGY067364 IRAK168G20 pBluescriptR BC066314 NM_000983 Full
HGY091317 IRAL028E21 pOTB7 BC011829 NM_000983 Partial/var
HGY096033 IRAL040B09 pOTB7 BC020237 NM_000983

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042931 ARe07F11 pKA1U5 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGCGNTAAAGCTTGTGGTGAAGGGGGGCA
HKR043612 ARe09A12 pKA1U5 NM_000983.3  
GCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR047380 ARe18H12 pKA1U5 NM_000983.3  
GGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAAAAAAGAAGCAAGT
HKR050555 ARe26G11 pKA1U5 NM_000983.3  
ACCTCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGG
HKR051649 ARe29C01 pKA1U5 NM_000983.3  
GCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR052036 ARe30B12 pKA1U5 NM_000983.3  
CTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAA
HKR052570 ARe31H02 pKA1U5 NM_000983.3  
GCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGANAAAGCTTGTGGTGAAGGGGGGCAA
HKR055701 ARe39E05 pKA1U5 NM_000983.3  
GCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR060101 ARe50E05 pKA1U5 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR060475 ARe51D03 pKA1U5 NM_000983.3  
GGCCGCCATGGCCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAAAAAAGAAGCAAG
HKR063654 ARe59C06 pKA1U5 NM_000983.3  
GCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGCTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR072028 ARe80B04 pKA1U5 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGCTGAAAAAGCTTGTGGTGAAGGGGGG
HKR074481 ARe86D09 pKA1U5 NM_000983.3  
GCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR075674 ARe89D02 pKA1U5 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGCTGAAAAAGCTTGTGGTGAAGGGGGG
HKR076010 ARe90A10 pKA1U5 NM_000983.3  
GCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR078078 ARe95D06 pKA1U5 NM_000983.3  
GCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGNTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR161732 ARi04F12 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR169749 ARi24G05 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGNNGAAGGGGGGCAA
HKR174082 ARi35D10 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR174175 ARi35H07 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR174932 ARi37F12 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR181635 ARi54B11 pGCAP10 NM_000983.3  
GCTTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR182952 ARi57G08 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR183775 ARi59H07 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR185660 ARi64C12 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGNGGNGANNGGGGNAAA
HKR205428 ARiS013J12 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR209500 ARiS023M12 pGCAP10 NM_000983.3  
GCTTTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGG
HKR219686 ARiS049D14 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR222252 ARiS055K12 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR234985 ARiS087H17 pGCAP10 NM_000983.3  
GCNTTCNNCNCCGCTGCCNCCANGNCTCCNGTGAAAAAGCTTGTGGTGAAGGGGGGCAAA
HKR235494 ARiS088M06 pGCAP10 NM_000983.3  
TGACCTCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGG
HKR235553 ARiS088O17 pGCAP10 NM_000983.3  
GAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAAAAAA
HKR243724 ARiS109F04 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR243966 ARiS109P06 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR248928 ARiS122F08 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR324152 RBb10G08 pKA1U5 NM_000983.3  
AACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAAAAAAG
HKR327727 RBb19F07 pKA1U5 NM_000983.3  
GCCCTTTCTACTCCGCTGCCGCCATGGCTCCTGCTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR328449 RBb21C01 pKA1U5 NM_000983.3  
GTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTCGTGGTGAAGGGGGGCAAAAA
HKR336948 RBb42G04 pGCAP1 NM_000983.3  
GAGCCGCCGCGTGTCACTGCGCGTGTTTTGTCCCAGCCGTGGCCGGGTGCGCAGCTTAAA
HKR338827 RBb47B03 pGCAP1 NM_000983.3  
GGCTTTTCGAACTCCGCNTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGG
HKR345376 RBb63H08 pGCAP1 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR360481 RBd01D09 pGCAP10 NM_000983.3  
GGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAAAAAAGAAGCA
HKR360875 RBd02D03 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR364833 RBd12B09 pGCAP10 NM_000983.3  
GCTTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR366971 RBd17H03 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR368030 RBd20B06 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR372907 RBd32E11 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR378459 RBd46C11 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR379229 RBd48B05 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR383657 RBd59C09 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR393255 RBd83C07 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR394146 RBd85G02 pGCAP10 NM_000983.3  
GTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR394156 RBd85G12 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR397601 RBd94A01 pGCAP10 NM_000983.3  
GGGGCTCTTTGCGTCTGCGTAGTTCGCTCACCTCCCTTTCTAACTCCGCTGCCGCCATGG
HKR398925 RBd97F05 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR399703 RBd99E07 pGCAP10 NM_000983.3  
GGCTGCGGGCTCTTTGCGTCTGCGTAGTTCGCTCACCTCCCTTTCTAACTCCGCTGCCGC
HKR403042 RBdS007K02 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR403151 RBdS007O15 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR405289 RBdS013D17 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR405670 RBdS014C22 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR416042 RBdS040B18 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR420561 RBdS051G17 pGCAP10 NM_000983.3  
GCTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR420624 RBdS051J08 pGCAP10 NM_000983.3  
GCTTTTTTTCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGA
HKR420643 RBdS051K03 pGCAP10 NM_000983.3  
GCTTTTCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGG
HKR420690 RBdS051M02 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR428153 RBdS070G09 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR428231 RBdS070J15 pGCAP10 NM_000983.3  
GCTTTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR428233 RBdS070J17 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR428332 RBdS070N20 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR430050 RBdS075C02 pGCAP10 NM_000983.3  
GCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA
HKR432460 RBdS081C12 pGCAP10 NM_000983.3  
GGTCTGCGTAGTTCGCTCACCTCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAA
HKR432739 RBdS081O03 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR441847 RBdS104K07 pGCAP10 NM_000983.3  
GGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAAAAAAAAGAAGCA
HKR441909 RBdS104M21 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR452869 RBdS132C21 pGCAP10 NM_000983.3  
GCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCAA
HKR453026 RBdS132J10 pGCAP10 NM_000983.3  
GCCCTTTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGC
HKR462609 RBdS156I17 pGCAP10 NM_000983.3  
GCNNNTCTAACTCCGCTGCCGCCATGGCTCCTGTGAAAAAGCTTGTGGTGAAGGGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl