Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051P05

Clone ID RBdS051P05
HP ID HP00032
Gene ID 9349
Gene Symbol RPL23
Protein Name ribosomal protein L23
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000978.3
Length of RefSeq (bp) 594
Chromosome 17q21.2
Reference DDBJ accession
UniGene Hs.406300
5'-terminal sequence GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
2011.08.28