Prev. |  KEGG KO K02894 > 

RIKEN DNA Bank Human Resource - RPL23

Gene ID NCBI Gene 9349 |  KEGG hsa:9349
Gene Symbol RPL23
Protein Name ribosomal protein L23
Synonyms L23|rpL17
Ortholog resources KEGG ortholog (KEGG orthology K02894) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17324 pFLAG-CMV-5a-RPL23 Expression vector of human RPL23 tagged with FLAG at C-terminus.
RDB17325 pGEX6P-1-RPL23 Bacterial expression vector of human RPL23 tagged with GST at N-terminus.
RDB17326 pET-28a-RPL23 Bacterial expression vector of human RPL23 tagged with 6xHis and T7 at N-terminus.
RDB17327 pCLH'CX-His-T7-RPL23 Retroviral expression vector of human RPL23 tagged with 6xHis and T7 at N-terminus.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020126 IRAK050F06 pCMV-SPORT6 BC034378 NM_000978 Partial
HGY085447 IRAL013K07 pOTB7 BC003518 NM_000978 Partial
HGY090956 IRAL027G12 pOTB7 BC010114 NM_000978 Full
HGY100473 IRAL051D01 pDNR-LIB BC062716 NM_000978 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052026 ARe30B02 pKA1U5 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR066549 ARe66G05 pKA1U5 NM_000978.3  
GTGCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCT
HKR067633 ARe69B09 pKA1U5 NM_000978.3  
ATCCTGCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCT
HKR072826 ARe82B02 pKA1U5 NM_000978.3  
GGAATCGACTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTG
HKR077374 ARe93H06 pKA1U5 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR082178 ARf05H10 pKA1U5 NM_000978.3  
GCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAAT
HKR160550 ARi01G06 pGCAP10 NM_000978.3  
GCCTTTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCT
HKR164032 ARi10B08 pGCAP10 NM_000978.3  
CTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTG
HKR164809 ARi12A09 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR164849 ARi12C01 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR165299 ARi13E03 pGCAP10 NM_000978.3  
TTGCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTG
HKR171723 ARi29F03 pGCAP10 NM_000978.3  
TTTTTTTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCG
HKR177204 ARi43A04 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR182812 ARi57A12 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR182906 ARi57E10 pGCAP10 NM_000978.3  
CGCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR185346 ARi63G02 pGCAP10 NM_000978.3  
GCTTTTTTCCGGCGTTCAAGATGTCNAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAAT
HKR203517 ARiS008N05 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR203541 ARiS008O05 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR205563 ARiS013P03 pGCAP10 NM_000978.3  
GCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAAT
HKR208047 ARiS020B23 pGCAP10 NM_000978.3  
GTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCT
HKR219859 ARiS049K19 pGCAP10 NM_000978.3  
TTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCG
HKR238742 ARiS096O06 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR247367 ARiS118G23 pGCAP10 NM_000978.3  
TTTTTTCTTTTTTCCGGCNTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGC
HKR249000 ARiS122I08 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR260132 ARiS150F12 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR264436 ARiS161B12 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR277905 ARiS194M17 pGCAP10 NM_000978.3  
GTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAATT
HKR277982 ARiS194P22 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR321378 RBb03H10 pKA1U5 NM_000978.3  
GCTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTC
HKR324458 RBb11C10 pKA1U5 NM_000978.3  
GCTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTC
HKR334104 RBb35E08 pGCAP1 NM_000978.3  
TGCGGTTTTTGCTCCGGCCACGTGAGGAGGGTGGGCGGGGCGTTAAAGTTCATATCCCAG
HKR336031 RBb40B07 pGCAP1 NM_000978.3  
AGCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTG
HKR338106 RBb45E10 pGCAP1 NM_000978.3  
GTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAATTCCGGA
HKR338473 RBb46D01 pGCAP1 NM_000978.3  
HKR341372 RBb53H04 pGCAP1 NM_000978.3  
TTTTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR342976 RBb57H08 pGCAP1 NM_000978.3  
TTTTTCTTTTTTCCGGCGCTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGC
HKR343354 RBb58G10 pGCAP1 NM_000978.3  
GGTTCATATCCCAGTGTCCTTTGAATCGACTTCCTTTTTTCTTTTTTCCGGCGTTCAAGA
HKR343611 RBb59A11 pGCAP1 NM_000978.3  
GCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAAT
HKR360432 RBd01B08 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR372412 RBd31A12 pGCAP10 NM_000978.3  
GATCCCAGTGTCCTTTGAATCGACTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGA
HKR383307 RBd58E11 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR385633 RBd64B09 pGCAP10 NM_000978.3  
CCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR395349 RBd88G05 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR395747 RBd89G03 pGCAP10 NM_000978.3  
GCTTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCT
HKR397234 RBd93B10 pGCAP10 NM_000978.3  
TAGCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTG
HKR397332 RBd93F12 pGCAP10 NM_000978.3  
GCTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTC
HKR406190 RBdS015H22 pGCAP10 NM_000978.3  
GCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAAT
HKR406333 RBdS015N21 pGCAP10 NM_000978.3  
TTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAATTC
HKR409112 RBdS022M24 pGCAP10 NM_000978.3  
GCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAAT
HKR416027 RBdS040B03 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR416110 RBdS040E14 pGCAP10 NM_000978.3  
GCNTGNTTCTTGTNCNCCNCTCTCANNANGNNCCACCGNGGNGGNNGCGGGGCNTGGGGT
HKR420765 RBdS051P05 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR428315 RBdS070N03 pGCAP10 NM_000978.3  
GCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGT
HKR432575 RBdS081H07 pGCAP10 NM_000978.3  
GCTTTTCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCC
HKR441973 RBdS104P13 pGCAP10 NM_000978.3  
GTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAATT
HKR442144 RBdS105F24 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG
HKR470968 RBdS177G24 pGCAP10 NM_000978.3  
GCCTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl