Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051O05

Clone ID RBdS051O05
HP ID HP03661
Gene ID 11079
Gene Symbol RER1
Protein Name RER1 homolog (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007033.3
Length of RefSeq (bp) 3093
Chromosome 1pter-q24
Reference DDBJ accession
UniGene Hs.525527
5'-terminal sequence GGGAGCCGGAGCGCAGCGCCTGCGGCCGCCCGTGCCCCGCCGTCCTCCTTCCCGCGGCCG
2011.08.28