Prev. | 

RIKEN DNA Bank Human Resource - RER1

Gene ID NCBI Gene 11079 |  KEGG hsa:11079
Gene Symbol RER1
Protein Name retention in endoplasmic reticulum sorting receptor 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083532 IRAL008N20 pOTB7 BC004965 NM_007033 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048484 ARe21D12 pKA1U5 NM_007033.3  
GGGCCCTGGAGGCGGCGCCGCGGAGGACGGAGCGGAAGTGCTCGCTGCAGCTTCCCGGAG
HKR178903 ARi47E07 pGCAP10 NM_007033.3  
GGGAGCCGGAGCGCAGCGCCTGCGGCCGCCCGTGCCCCGCCGTCCTCCTTCCCGCGGCCG
HKR188457 ARi71C09 pGCAP10 NM_007033.3  
GGGCGCCGCGGAGGACGGAGCGGAAGTGCTCGCTGCAGCTTCCCGGAGCCGGAGCGCAGC
HKR203286 ARiS008D14 pGCAP10 NM_007033.3  
GGGAGGCGGCGCCGCGNAGGACGGAGCGGAAGTGCTCGCTGCAGCTTCCCGGAGCCGGAG
HKR331353 RBb28G09 pGCAP1 NM_007033.3  
GGCGGAAGTGCTCGCTGCAGCTTCCCGGAGCCGGAGCGCAGCGCCTGCGGCCGCCCGTGC
HKR420741 RBdS051O05 pGCAP10 NM_007033.3  
GGGAGCCGGAGCGCAGCGCCTGCGGCCGCCCGTGCCCCGCCGTCCTCCTTCCCGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl