Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051L05

Clone ID RBdS051L05
HP ID HP00204
Gene ID 6143
Gene Symbol RPL19
Protein Name ribosomal protein L19
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000981.3
Length of RefSeq (bp) 748
Chromosome 17q11.2-q12
Reference DDBJ accession
UniGene Hs.381061
5'-terminal sequence GCCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
2011.08.28