Prev. |  KEGG KO K02885 > 

RIKEN DNA Bank Human Resource - RPL19

Gene ID NCBI Gene 6143 |  KEGG hsa:6143
Gene Symbol RPL19
Protein Name ribosomal protein L19
Synonyms L19
Ortholog resources KEGG ortholog (KEGG orthology K02885) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067235 IRAK168B11 pBluescriptR BC066315 NM_000981 Full
HGY080732 IRAL001N20 pOTB7 BC000530 NM_000981 Full
HGY084112 IRAL010E16 pOTB7 BC013016 NM_000981 Full
HGY100700 IRAL051M12 pDNR-LIB BC062709 NM_000981 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081642 M01C004B18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081690 M01C004D18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081738 M01C004F18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081786 M01C004H18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081834 M01C004J18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081882 M01C004L18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081930 M01C004N18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE081978 M01C004P18 pDONR221 04-134-2_2-H09 AK130962 NM_000981  
HGE084846 M01C012B22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE084894 M01C012D22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE084942 M01C012F22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE084990 M01C012H22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE085038 M01C012J22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE085086 M01C012L22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE085134 M01C012N22 pDONR221 FLJ03-H11 AK130962 NM_000981  
HGE085182 M01C012P22 pDONR221 FLJ03-H11 AK130962 NM_000981  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041304 ARe03E08 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR043750 ARe09G06 pKA1U5 NM_000981.3  
GCCTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR045684 ARe14D12 pKA1U5 NM_000981.3  
GGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR049605 ARe24A05 pKA1U5 NM_000981.3  
TGCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR050930 ARe27F10 pKA1U5 NM_000981.3  
GGAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAG
HKR052482 ARe31D10 pKA1U5 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR054545 ARe36G01 pKA1U5 NM_000981.3  
ATGCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGATTATGCTCAGGCTTCAGAAGAGGCT
HKR058952 ARe47G08 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTNAGGCTTCAGAAGAGGCTCGCCTC
HKR061703 ARe54E07 pKA1U5 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR064076 ARe60D04 pKA1U5 NM_000981.3  
GTTTCCTTTCGCTGCTGCGGCCGCAGCCATGANTATGCTCAGGCTTCAGAAGAGGCTCGC
HKR066129 ARe65F09 pKA1U5 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR066831 ARe67B07 pKA1U5 NM_000981.3  
GTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGC
HKR067684 ARe69D12 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGGTATGCTTCAGGCTTCAGAAGAGGCTCGCC
HKR070427 ARe76B03 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATNCNTNAGGCTTCAGAAGAGGCTCGCCT
HKR072178 ARe80H10 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR072497 ARe81E01 pKA1U5 NM_000981.3  
ATCCTGGTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAG
HKR074025 ARe85B01 pKA1U5 NM_000981.3  
ATCCTGTTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAG
HKR075204 ARe88A04 pKA1U5 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR076402 ARe91A02 pKA1U5 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR076899 ARe92E03 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR077607 ARe94A07 pKA1U5 NM_000981.3  
GCTTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR077698 ARe94E02 pKA1U5 NM_000981.3  
GCTTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR079636 ARe99B12 pKA1U5 NM_000981.3  
GGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR080900 ARf02E04 pKA1U5 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR082012 ARf05A12 pKA1U5 NM_000981.3  
TGGGTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR161607 ARi04A07 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR164577 ARi11H09 pGCAP10 NM_000981.3  
GGCAGATAATGGGAGGAGCCGGGCCCGAGCGAGCTCTTTCCTTTCGCTGCTGCGGCCGCA
HKR164882 ARi12D10 pGCAP10 NM_000981.3  
GCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCT
HKR165211 ARi13A11 pGCAP10 NM_000981.3  
GTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCT
HKR166833 ARi17B09 pGCAP10 NM_000981.3  
GCCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR167306 ARi18E10 pGCAP10 NM_000981.3  
GCCTTTCGCTGCNTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCT
HKR169332 ARi23F12 pGCAP10 NM_000981.3  
TGGCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCC
HKR171305 ARi28E09 pGCAP10 NM_000981.3  
TGGCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCC
HKR176947 ARi42G03 pGCAP10 NM_000981.3  
TTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR177729 ARi44F09 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR181780 ARi54H12 pGCAP10 NM_000981.3  
GCTTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR182059 ARi55C11 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR182505 ARi56E09 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR182507 ARi56E11 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR183649 ARi59C01 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR184574 ARi61H06 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR203285 ARiS008D13 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR203414 ARiS008I22 pGCAP10 NM_000981.3  
CGGCCGGCCGATTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTC
HKR208198 ARiS020I06 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR218054 ARiS045C06 pGCAP10 NM_000981.3  
GCTCTTNNNTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCT
HKR218196 ARiS045I04 pGCAP10 NM_000981.3  
GCTTTCCTTTCNCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR219821 ARiS049J05 pGCAP10 NM_000981.3  
GTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR222021 ARiS055A21 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR234948 ARiS087G04 pGCAP10 NM_000981.3  
GCCCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCC
HKR238537 ARiS096F17 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR243902 ARiS109M14 pGCAP10 NM_000981.3  
TGGCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCC
HKR260123 ARiS150F03 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR264634 ARiS161J18 pGCAP10 NM_000981.3  
GCCTTTCNCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR277767 ARiS194G23 pGCAP10 NM_000981.3  
GCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCT
HKR277847 ARiS194K07 pGCAP10 NM_000981.3  
TGTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR323228 RBb08B04 pKA1U5 NM_000981.3  
GGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR324102 RBb10E06 pKA1U5 NM_000981.3  
TGGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGTAGATATGCTCAGGCTTCAGAAGA
HKR329769 RBb24H01 pGCAP1 NM_000981.3  
GTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGC
HKR331657 RBb29C09 pGCAP1 NM_000981.3  
TCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR332977 RBb32H09 pGCAP1 NM_000981.3  
GCCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCT
HKR334079 RBb35D07 pGCAP1 NM_000981.3  
ATCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCT
HKR334522 RBb36F02 pGCAP1 NM_000981.3  
GGAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAG
HKR341704 RBb54E08 pGCAP1 NM_000981.3  
AAATGTGTGCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAA
HKR343745 RBb59G01 pGCAP1 NM_000981.3  
TGTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCT
HKR345226 RBb63B02 pGCAP1 NM_000981.3  
AAAGCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGC
HKR345346 RBb63G02 pGCAP1 NM_000981.3  
GGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR345660 RBb64C12 pGCAP1 NM_000981.3  
GGAGCGAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGA
HKR346803 RBb67A03 pGCAP1 NM_000981.3  
GGTGCCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGG
HKR346947 RBb67G03 pGCAP1 NM_000981.3  
AAATGTGGCCCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAG
HKR347649 RBb69C01 pGCAP1 NM_000981.3  
TCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR347655 RBb69C07 pGCAP1 NM_000981.3  
GGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR348130 RBb70F10 pGCAP1 NM_000981.3  
GGCAGATAATGGGAGGAGCCGGGCCCGAGCGAGCTCTTTCCTTTCGCTGCTGCGGCCGCA
HKR348425 RBb71B01 pGCAP1 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR348479 RBb71D07 pGCAP1 NM_000981.3  
GGTGTTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR348803 RBb72A03 pGCAP1 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR366873 RBd17D01 pGCAP10 NM_000981.3  
GCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCT
HKR368178 RBd20H10 pGCAP10 NM_000981.3  
GGAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAG
HKR368554 RBd21G10 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR369209 RBd23A09 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR370152 RBd25G08 pGCAP10 NM_000981.3  
GCCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCT
HKR370573 RBd26H05 pGCAP10 NM_000981.3  
CGGCCGGCCGATGCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAA
HKR372830 RBd32B06 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR372874 RBd32D02 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR373349 RBd33G05 pGCAP10 NM_000981.3  
GGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR373656 RBd34C08 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR380128 RBd50F08 pGCAP10 NM_000981.3  
TCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR382431 RBd56B07 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTNNNNAGAGGCTCGCCTC
HKR384010 RBd60A10 pGCAP10 NM_000981.3  
GAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGG
HKR385677 RBd64D05 pGCAP10 NM_000981.3  
GGCAGATAATGGGAGGAGCCGGGCCCGAGCGAGCTCTTTCCTTTCGCTGCTGCGGCCGCA
HKR386906 RBd67E10 pGCAP10 NM_000981.3  
GATGAGGTGAGGGCGAGCTGGTCTCCATCAGGCGCTGACGCGTGTCGACAAGGGACTGTC
HKR390001 RBd75A01 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR394154 RBd85G10 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR394570 RBd86H02 pGCAP10 NM_000981.3  
GTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCC
HKR405228 RBdS013B04 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR405424 RBdS013J08 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR416002 RBdS040A02 pGCAP10 NM_000981.3  
GCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCT
HKR416004 RBdS040A04 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCNGCCATGANTATGCTCANGCTTCAGAAGAGGCTCG
HKR420669 RBdS051L05 pGCAP10 NM_000981.3  
GCCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR430215 RBdS075I23 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR432630 RBdS081J14 pGCAP10 NM_000981.3  
AGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR432649 RBdS081K09 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR433456 RBdS083K16 pGCAP10 NM_000981.3  
GTCTTNCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC
HKR444285 RBdS110L21 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR470987 RBdS177H19 pGCAP10 NM_000981.3  
GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
HKR471054 RBdS177K14 pGCAP10 NM_000981.3  
AGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGC
HKR471109 RBdS177M21 pGCAP10 NM_000981.3  
GCCTTTCGCTGCTGCGGCCGCANCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTC
HKR475165 RBdS187P05 pGCAP10 NM_000981.3  
GTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl