Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051K05

Clone ID RBdS051K05
HP ID HP03064
Gene ID 285855
Gene Symbol RPL7L1
Protein Name ribosomal protein L7-like 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_198486.2
Length of RefSeq (bp) 1293
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.520133
5'-terminal sequence TGGTACCACCACTAGAAAGATGGCGGAGCAAGAGCAAAGAAAAATCCCTTTGGTTCCAGA
2011.08.28