Prev. | 

RIKEN DNA Bank Human Resource - RPL7L1

Gene ID NCBI Gene 285855 |  KEGG hsa:285855
Gene Symbol RPL7L1
Protein Name ribosomal protein L7 like 1
Synonyms dJ475N16.4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055671 IRAK139C23 pCMV-SPORT6 BC064519 NM_198486 Full/var
HGX066718 IRAK166N06 pCMV-SPORT6 BC073890 NM_198486
HGY099519 IRAL048N07 pDNR-LIB BC058020 NM_198486 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090043 M01C025B19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090091 M01C025D19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090139 M01C025F19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090187 M01C025H19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090235 M01C025J19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090283 M01C025L19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090331 M01C025N19 pDONR221 MGC02-C10 BC058020 NM_198486  
HGE090379 M01C025P19 pDONR221 MGC02-C10 BC058020 NM_198486  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183698 ARi59E02 pGCAP10 NM_198486.2  
GAGCTGCACCACTAGAAAGATGGCGGAGCAAGAGCAAAGAAAAATCCCTTTGGTTCCAGA
HKR420645 RBdS051K05 pGCAP10 NM_198486.2  
TGGTACCACCACTAGAAAGATGGCGGAGCAAGAGCAAAGAAAAATCCCTTTGGTTCCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl