Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051E12

Clone ID RBdS051E12
HP ID HP10316
Gene ID 10535
Gene Symbol RNASEH2A
Protein Name ribonuclease H2, subunit A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006397.2
Length of RefSeq (bp) 1148
Chromosome 19p13.13
Reference DDBJ accession
UniGene Hs.532851
5'-terminal sequence GGCAGCTGGTGGCGGCGGCTGAGGCGGCATGGATCTCAGCGAGCTGGAGAGAGACAATAC
2011.08.28