Prev. |  KEGG KO K10743 > 

RIKEN DNA Bank Human Resource - RNASEH2A

Gene ID NCBI Gene 10535 |  KEGG hsa:10535
Gene Symbol RNASEH2A
Protein Name ribonuclease H2 subunit A
Synonyms AGS4|JUNB|RNASEHI|RNHIA|RNHL
Ortholog resources KEGG ortholog (KEGG orthology K10743) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090844 IRAL027B20 pOTB7 BC011748 NM_006397 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050949 ARe27G05 pKA1U5 NM_006397.2  
GATTGGCCGGAAGCAGGCGCCGCTTCGAGGCCCGCTTAAAACGCGCGCCGAGACCCGCTC
HKR342556 RBb56G12 pGCAP1 NM_006397.2  
GGCCGCTTCGAGGCCCGCGGTAAAACGCGCGCCGAGACCCGCTCCTGCAGTATTAGTTTC
HKR347699 RBb69E03 pGCAP1 NM_006397.2  
TGGCTCCTGCAGTATTAGTTCTTGCAGCTGGTGGCGGCGGCTGAGGCGGCATGGATCTCA
HKR382124 RBd55F04 pGCAP10 NM_006397.2  
GAGGGGCGTGTTCTGCCCGCGGATTGGCCGGAAGCAGGCGCCNNNNNGAGGCCCGCGGAA
HKR383275 RBd58D03 pGCAP10 NM_006397.2  
GCTTGCAGCTGGTGGCGGCGGCTGAGGCGGCATGGATCTCACCGAGCTGGAGAGAGACAA
HKR416211 RBdS040I19 pGCAP10 NM_006397.2  
GAGTATTAGTTCTTGCAGCTGGTGGCGGCGGCTGAGGCGGCATGGATCTCAGCGAGCTGG
HKR420508 RBdS051E12 pGCAP10 NM_006397.2  
GGCAGCTGGTGGCGGCGGCTGAGGCGGCATGGATCTCAGCGAGCTGGAGAGAGACAATAC
HKR441740 RBdS104F20 pGCAP10 NM_006397.2  
GAGGCGCCGCTTCGAGGCCCGCGGAAAACGCGCGCCGAGACCCGCTCCTGCAGTATTAGT
HKR442217 RBdS105J01 pGCAP10 NM_006397.2  
GGGCCGGAAGCAGGCGCCGCTTCGAGGCCCGCGGAAAACGCGCGCCGAGACCCGCTCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl