Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040P02

Clone ID RBdS040P02
HP ID HP05228
Gene ID 5877
Gene Symbol RABIF
Protein Name RAB interacting factor
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002871.3
Length of RefSeq (bp) 2452
Chromosome 1q32-q41
Reference DDBJ accession
UniGene Hs.90875
5'-terminal sequence GAATAACGAGCCAGCAGAGACAGCGTCTGCGCAGCCGTGGCTGAGGAGCCTGTGGCGGCA
2011.08.28