Prev. |  KEGG KO K19952 > 

RIKEN DNA Bank Human Resource - RABIF

Gene ID NCBI Gene 5877 |  KEGG hsa:5877
Gene Symbol RABIF
Protein Name RAB interacting factor
Synonyms MSS4|RASGFR3|RASGRF3
Ortholog resources KEGG ortholog (KEGG orthology K19952) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011295 IRAK028D23 pCMV-SPORT6 BC018488 NM_002871 Full
HGX020259 IRAK050K19 pCMV-SPORT6 BC037392 NM_002871

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322101 RBb05E05 pKA1U5 NM_002871.3  
GGACAGCGTCTGCGCAGCCGTGGCTGAGGAGCCTGTGGCGGCAGCGGCGATGGAACCAGC
HKR326081 RBb15D09 pKA1U5 NM_002871.3  
GGGCGGCAGCGGCGATGGAACCAGCGGAGCAGCCGAGCGAGTTAGTGTCAGCCGAGGGCC
HKR416362 RBdS040P02 pGCAP10 NM_002871.3  
GAATAACGAGCCAGCAGAGACAGCGTCTGCGCAGCCGTGGCTGAGGAGCCTGTGGCGGCA
HKR420523 RBdS051F03 pGCAP10 NM_002871.3  
GGCCTGTGGCGGCAGCGGCGATGGAACCAGCGGAGCAGCCGAGCGAGTTAGTGTCAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl