Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040J08

Clone ID RBdS040J08
HP ID HP00085
Gene ID 6202
Gene Symbol RPS8
Protein Name ribosomal protein S8
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001012.1
Length of RefSeq (bp) 705
Chromosome 1p34.1-p32
Reference DDBJ accession
UniGene Hs.512675
5'-terminal sequence GTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
2011.08.28