Prev. |  KEGG KO K02995 > 

RIKEN DNA Bank Human Resource - RPS8

Gene ID NCBI Gene 6202 |  KEGG hsa:6202
Gene Symbol RPS8
Protein Name ribosomal protein S8
Synonyms S8
Ortholog resources KEGG ortholog (KEGG orthology K02995) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001550 IRAK003O14 pCMV-SPORT6 BC005678 NM_001012 Partial
HGX069966 IRAK174P06 pCMV-SPORT6 BC070875 NM_001012 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040436 ARe01B12 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR040875 ARe02D03 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR041625 ARe04B01 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR041751 ARe04G07 pKA1U5 NM_001012.1  
GGCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR042123 ARe05F03 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR044525 ARe11F05 pKA1U5 NM_001012.1  
TGCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR048172 ARe20H04 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR050956 ARe27G12 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR051204 ARe28A04 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR053749 ARe34G05 pKA1U5 NM_001012.1  
AGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCAAAACCGGG
HKR054129 ARe35F09 pKA1U5 NM_001012.1  
CTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCA
HKR055651 ARe39C03 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR056578 ARe41H10 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR060171 ARe50H03 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR064880 ARe62D08 pKA1U5 NM_001012.1  
GCTTTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR068928 ARe72F08 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR070036 ARe75B12 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTNGGGACAACTGGCACAAGCGCCGC
HKR071609 ARe79A09 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR074036 ARe85B12 pKA1U5 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR074882 ARe87D10 pKA1U5 NM_001012.1  
TGCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR075626 ARe89B02 pKA1U5 NM_001012.1  
ATCCTGTTTGCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCAC
HKR076500 ARe91E04 pKA1U5 NM_001012.1  
GCTTTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR077376 ARe93H08 pKA1U5 NM_001012.1  
CTCTCTTTCCGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR160481 ARi01D09 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR162549 ARi06G05 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR166126 ARi15F06 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR169673 ARi24D01 pGCAP10 NM_001012.1  
GATCTTTGCGGTTTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTG
HKR173611 ARi34A11 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR176548 ARi41G04 pGCAP10 NM_001012.1  
GCTTTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR180176 ARi50H08 pGCAP10 NM_001012.1  
CTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCA
HKR181206 ARi53A06 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR185354 ARi63G10 pGCAP10 NM_001012.1  
GCTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCC
HKR203277 ARiS008D05 pGCAP10 NM_001012.1  
TGTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCC
HKR203342 ARiS008F22 pGCAP10 NM_001012.1  
GGCGGTTTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAA
HKR205468 ARiS013L04 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR234169 ARiS085H01 pGCAP10 NM_001012.1  
GGCGGGGCAGCGTTTTACAAACCGAACCGTGAATCTTTGCGGTTTCTCTTTCCAGCCAGC
HKR234218 ARiS085J02 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR235256 ARiS088C08 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR235559 ARiS088O23 pGCAP10 NM_001012.1  
TTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR238657 ARiS096K17 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR238685 ARiS096L21 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR260108 ARiS150E12 pGCAP10 NM_001012.1  
CTTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCC
HKR264754 ARiS161O18 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR276750 ARiS191O14 pGCAP10 NM_001012.1  
ATGAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCAAAACC
HKR279365 ARiS198G21 pGCAP10 NM_001012.1  
HKR326812 RBb17A12 pKA1U5 NM_001012.1  
GCTCTTTCCGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCA
HKR326897 RBb17E01 pKA1U5 NM_001012.1  
GCTCTTTCCGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCA
HKR329202 RBb23A02 pGCAP1 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR330035 RBb25B11 pGCAP1 NM_001012.1  
TGCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR330125 RBb25F05 pGCAP1 NM_001012.1  
GCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCAAAACC
HKR330923 RBb27F03 pGCAP1 NM_001012.1  
TGTCTCTTTCCGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR343724 RBb59F04 pGCAP1 NM_001012.1  
TCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR344577 RBb61H09 pGCAP1 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR346874 RBb67D02 pGCAP1 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR360806 RBd02A06 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR364075 RBd10D03 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR375234 RBd38B10 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR378080 RBd45D08 pGCAP10 NM_001012.1  
GAGTCTCCTCGGAGCGATGGGCAACTCTCAGGACACCTGGCACATGCGCCGCTTAACCGG
HKR380553 RBd51G09 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR382127 RBd55F07 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGNNNNNTNNNACAAGCGCCGC
HKR382454 RBd56C06 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGNCNNNTNNNACAAGCGCCGC
HKR382529 RBd56F09 pGCAP10 NM_001012.1  
GCTCTTTCCNGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACNGGCACAAGCGCCGC
HKR383650 RBd59C02 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR386033 RBd65B09 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR390010 RBd75A10 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR390521 RBd76F01 pGCAP10 NM_001012.1  
GAAAGGGGCGGGGCAGCGTTTTACAAACCGAACCGTGAATCTTTGCGGTTTCTCTTTCCA
HKR390927 RBd77F07 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR392483 RBd81D11 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR392527 RBd81F07 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR393350 RBd83G06 pGCAP10 NM_001012.1  
GGAGTGTCGCTCTGCATTGAGGCGGGTGAAGGGAGGTTGAGCTCAATCAGGCCCCATCCT
HKR394951 RBd87G07 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR395609 RBd89A09 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR396952 RBd92G08 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR399229 RBd98B05 pGCAP10 NM_001012.1  
GCTCTTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR399253 RBd98C05 pGCAP10 NM_001012.1  
TTTCTTTTCCAGCCGGCCCCTANCGATGGGCATCTCTCATGACAACTGGCAAAAGCGCCG
HKR405295 RBdS013D23 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR405654 RBdS014C06 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR405708 RBdS014E12 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR406296 RBdS015M08 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR409107 RBdS022M19 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR416224 RBdS040J08 pGCAP10 NM_001012.1  
GTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR420715 RBdS051N03 pGCAP10 NM_001012.1  
GATCTTTGCGGTTTCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTG
HKR420748 RBdS051O12 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR428286 RBdS070L22 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR432534 RBdS081F14 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR432539 RBdS081F19 pGCAP10 NM_001012.1  
TGCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCG
HKR433578 RBdS083P18 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR441968 RBdS104P08 pGCAP10 NM_001012.1  
GCTCTTTCCAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
HKR475075 RBdS187L11 pGCAP10 NM_001012.1  
GAGCCAGCGCCGAGCGATGGGCATCTCTCGGGACAACTGGCACAAGCGCCGCAAAACCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl