Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040J01

Clone ID RBdS040J01
HP ID HP00486
Gene ID 6141
Gene Symbol RPL18
Protein Name ribosomal protein L18
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000979.2
Length of RefSeq (bp) 648
Chromosome 19q13
Reference DDBJ accession
UniGene Hs.515517
5'-terminal sequence GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
2011.08.28