Prev. |  KEGG KO K02883 > 

RIKEN DNA Bank Human Resource - RPL18

Gene ID NCBI Gene 6141 |  KEGG hsa:6141
Gene Symbol RPL18
Protein Name ribosomal protein L18
Synonyms L18
Ortholog resources KEGG ortholog (KEGG orthology K02883) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005667 IRAK014C19 pCMV-SPORT6 BC009708 NM_000979 Full
HGY018926 IRAK047F06 pBluescriptR BC021743 NM_000979 Full/var
HGY080452 IRAL001C04 pOTB7 BC000374 NM_000979 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040483 ARe01D11 pKA1U5 NM_000979.2  
GCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAAC
HKR044429 ARe11B05 pKA1U5 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR047303 ARe18E07 pKA1U5 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR047607 ARe19A07 pKA1U5 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR054056 ARe35C08 pKA1U5 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR058555 ARe46G11 pKA1U5 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR065725 ARe64F05 pKA1U5 NM_000979.2  
GTTCTCTCTTTCCGGACCTGGCCGAGCAGGANGCGCCATCATGGGAGTGGACATCCNCCA
HKR067603 ARe69A03 pKA1U5 NM_000979.2  
TGGCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCA
HKR069602 ARe74A02 pKA1U5 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR073627 ARe84B03 pKA1U5 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR082829 ARf07B05 pKA1U5 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR164449 ARi11C01 pGCAP10 NM_000979.2  
GACCCCAGCCCGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTG
HKR165678 ARi14D06 pGCAP10 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR169699 ARi24E03 pGCAP10 NM_000979.2  
TGCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGNCATCCGCCATAACA
HKR170801 ARi27A01 pGCAP10 NM_000979.2  
GTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCA
HKR171730 ARi29F10 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR176569 ARi41H01 pGCAP10 NM_000979.2  
GTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAG
HKR203421 ARiS008J05 pGCAP10 NM_000979.2  
GGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAGGACCGAAAGGT
HKR235434 ARiS088J18 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR238629 ARiS096J13 pGCAP10 NM_000979.2  
GCTTTTTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATA
HKR248953 ARiS122G09 pGCAP10 NM_000979.2  
GCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAAC
HKR279207 ARiS198A07 pGCAP10 NM_000979.2  
GTTTTCCGGACCTGGCCGANCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR279270 ARiS198C22 pGCAP10 NM_000979.2  
GCCGNNNCNGGCCGCGCAGGAGGCGCCATCANNGGAGNGGNCNTCCGCCATAACAAGGAC
HKR279383 ARiS198H15 pGCAP10 NM_000979.2  
GTTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR334849 RBb37C01 pGCAP1 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR334873 RBb37D01 pGCAP1 NM_000979.2  
AGCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACA
HKR336430 RBb41B06 pGCAP1 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR339350 RBb48G06 pGCAP1 NM_000979.2  
GCTTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACA
HKR346460 RBb66C12 pGCAP1 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR361282 RBd03D10 pGCAP10 NM_000979.2  
GCTCTTTGCAGACCTGGGCTACCGCGACGACCCCTCTGGGCAGTGCACATCCGCCATTGG
HKR361370 RBd03H02 pGCAP10 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR364884 RBd12D12 pGCAP10 NM_000979.2  
HKR366883 RBd17D11 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR378179 RBd45H11 pGCAP10 NM_000979.2  
GCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAGGAC
HKR382035 RBd55B11 pGCAP10 NM_000979.2  
GNNTCTCTCTTTCCGGACCTNNGNCGANGCAGGANGCGCCATCNTGGTGAGTGGACATCC
HKR382036 RBd55B12 pGCAP10 NM_000979.2  
GNTTNTCTCTNTNNGGACCTGGCCGAGNNGGTAGGCGCCATCCTGNTNNNTGGACATCCN
HKR384854 RBd62C06 pGCAP10 NM_000979.2  
TGCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAA
HKR386876 RBd67D04 pGCAP10 NM_000979.2  
GCTTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACA
HKR386930 RBd67F10 pGCAP10 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR389775 RBd74H07 pGCAP10 NM_000979.2  
GTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAG
HKR392478 RBd81D06 pGCAP10 NM_000979.2  
GCTTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACA
HKR398049 RBd95C01 pGCAP10 NM_000979.2  
TGTTTTTTTACTTGGGTGAGCCAGTGGCGCCATCATGGGAGTTGTCATCCGTCATAACAC
HKR398074 RBd95D02 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR405460 RBdS013K20 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR409028 RBdS022J12 pGCAP10 NM_000979.2  
GCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAAC
HKR416217 RBdS040J01 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR428201 RBdS070I09 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR441808 RBdS104I16 pGCAP10 NM_000979.2  
GGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCC
HKR444175 RBdS110H07 pGCAP10 NM_000979.2  
GCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAA
HKR444290 RBdS110M02 pGCAP10 NM_000979.2  
GCCGTTCTCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCG
HKR462457 RBdS156C09 pGCAP10 NM_000979.2  
GCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAAC
HKR475085 RBdS187L21 pGCAP10 NM_000979.2  
GCTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl