Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040E12

Clone ID RBdS040E12
HP ID HP00490
Gene ID 6171
Gene Symbol RPL41
Protein Name ribosomal protein L41
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_021104.1
Length of RefSeq (bp) 478
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.632703
5'-terminal sequence GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
2011.08.28