Prev. |  KEGG KO K02928 > 

RIKEN DNA Bank Human Resource - RPL41

Gene ID NCBI Gene 6171 |  KEGG hsa:6171
Gene Symbol RPL41
Protein Name ribosomal protein L41
Synonyms L41
Ortholog resources KEGG ortholog (KEGG orthology K02928) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027894 IRAK069M06 pCMV-SPORT6 BC032611 NM_021104 Full
HGX056103 IRAK140E07 pCMV-SPORT6 BC064907 NM_021104 Full
HGX056679 IRAK141L15 pCMV-SPORT6 BC062462 NM_021104 Full
HGY066869 IRAK167C21 pBluescriptR BC066328 NM_021104 Full
HGX069956 IRAK174O20 pCMV-SPORT6 BC070483 NM_021104 Full
HGY092752 IRAL031O16 pDNR-LIB BC014383 NM_021104 Full
HGY093034 IRAL032J18 pDNR-LIB BC015984 NM_021104 Full
HGY094630 IRAL036J14 pDNR-LIB BC017820 NM_021104 Full
HGY102943 IRAL057F23 pDNR-LIB BC070252 NM_021104 Full
HGY103111 IRAL057M23 pDNR-LIB BC070253 NM_021104 Full
HGY103123 IRAL057N11 pDNR-LIB BC070255 NM_021104 Full
HGY103125 IRAL057N13 pDNR-LIB BC070254 NM_021104 Full
HGY103664 IRAL059C16 pOTB7 BC082759 NM_021104 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042551 ARe06G07 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR043322 ARe08F02 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR043324 ARe08F04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR045608 ARe14A08 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR047283 ARe18D11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR047327 ARe18F07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR048033 ARe20B09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR048056 ARe20C08 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR048106 ARe20E10 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR048107 ARe20E11 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR048126 ARe20F06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR049208 ARe23A08 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR049659 ARe24C11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR050082 ARe25D10 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR051300 ARe28E04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR051654 ARe29C06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR052056 ARe30C08 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR052128 ARe30F08 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR052455 ARe31C07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR053235 ARe33B11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR055377 ARe38H09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR055676 ARe39D04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCNCTGTNCCATGAGAGCCAAGTGGAGGA
HKR056078 ARe40D06 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR056129 ARe40F09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR056177 ARe40H09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR056573 ARe41H05 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR056803 ARe42A03 pKA1U5 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR056830 ARe42B06 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR057233 ARe43B09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR057325 ARe43F05 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR059252 ARe48C04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR059774 ARe49H06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTTGCGCCATGAGAGCCAAGTGGAGG
HKR060005 ARe50A05 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR060527 ARe51F07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR060946 ARe52G02 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCNCTGCGCCATGAGAGCCAAGTGGAGGA
HKR061225 ARe53B01 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR062059 ARe55C11 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTTGGAANCCTCTGCGCCATGAGAGCCAAGTGGAG
HKR063236 ARe58B12 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR063251 ARe58C03 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR063307 ARe58E11 pKA1U5 NM_021104.1  
ATCCTGGTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAG
HKR063775 ARe59H07 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR064151 ARe60G07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR064406 ARe61A06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCNCTTGCGCCATGAGAGCCAAGTGGAGG
HKR064425 ARe61B01 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTNGGAAACCCCCTTTAAAGGGGCAGAGCCAAGTGGA
HKR064497 ARe61E01 pKA1U5 NM_021104.1  
TGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR064904 ARe62E08 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR065257 ARe63C09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR066078 ARe65D06 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR066108 ARe65E12 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGGCTGAAG
HKR066402 ARe66A02 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR066405 ARe66A05 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR066579 ARe66H11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCNTTTNGCCATGAGAGCCAAGTGGAGGA
HKR067229 ARe68B05 pKA1U5 NM_021104.1  
CTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGGTGAGCGG
HKR068035 ARe70B11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR068804 ARe72A04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR068829 ARe72B05 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR068974 ARe72H06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCCCTTNGCCATGAGAGCCAAGTGGAGGA
HKR069212 ARe73A12 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCNCTTGCGCCATGAGAGCCAAGTGGAGG
HKR069770 ARe74H02 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR070901 ARe77E05 pKA1U5 NM_021104.1  
TGTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTNTGCGCCATGAGAGCCAAGTGGAG
HKR072449 ARe81C01 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR073278 ARe83D06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR073703 ARe84E07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR073749 ARe84G05 pKA1U5 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR074850 ARe87C02 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR074902 ARe87E06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR076409 ARe91A09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR076527 ARe91F07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR076902 ARe92E06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR078145 ARe95G01 pKA1U5 NM_021104.1  
GCTCTCGGCCTTANCNCCTTTTTTTTGGAAACCTCTGCGCCATGTAGAGCCAAGTTGGAG
HKR078480 ARe96D08 pKA1U5 NM_021104.1  
ATCCTGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTG
HKR078571 ARe96H03 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR078833 ARe97B09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR078897 ARe97E01 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR078970 ARe97H02 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR079326 ARe98F06 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR081234 ARf03B10 pKA1U5 NM_021104.1  
ATCCTGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGT
HKR081324 ARf03F04 pKA1U5 NM_021104.1  
GCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAAG
HKR081629 ARf04B05 pKA1U5 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR082059 ARf05C11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR082946 ARf07G02 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR162029 ARi05B05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR162131 ARi05F11 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR162524 ARi06F04 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR162973 ARi07H05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR165374 ARi13H06 pGCAP10 NM_021104.1  
CGGCCGGCCGATGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAG
HKR165625 ARi14B01 pGCAP10 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR167332 ARi18F12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR167756 ARi19G12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR168171 ARi20H03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR168575 ARi21H07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR168831 ARi22B07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR168860 ARi22C12 pGCAP10 NM_021104.1  
CTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR171282 ARi28D10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR171376 ARi28H08 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR172973 ARi32H05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR172975 ARi32H07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR173707 ARi34E11 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR173773 ARi34H05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR174171 ARi35H03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR174971 ARi37H03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR175209 ARi38A09 pGCAP10 NM_021104.1  
CTCTCAGCCTAACCGCCATTTTATTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR175300 ARi38E04 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR175324 ARi38F04 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR175329 ARi38F09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR175726 ARi39F06 pGCAP10 NM_021104.1  
GCTCTCGNNNTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR175777 ARi39H09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR176080 ARi40D08 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR176180 ARi40H12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR176825 ARi42B01 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR178178 ARi45H10 pGCAP10 NM_021104.1  
CCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR178810 ARi47A10 pGCAP10 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR178904 ARi47E08 pGCAP10 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR179328 ARi48F08 pGCAP10 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR179633 ARi49B09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR180127 ARi50F07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR182079 ARi55D07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR182083 ARi55D11 pGCAP10 NM_021104.1  
TCCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR182126 ARi55F06 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR183298 ARi58E02 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR183374 ARi58H06 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR183631 ARi59B07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR184097 ARi60E01 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR184125 ARi60F05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR184473 ARi61D01 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR203205 ARiS008A05 pGCAP10 NM_021104.1  
CGGCCGGCCGATGGGGTGAGTGTTTTTTGGTTCCTGCGTTGGGATTCCGTGTACAATCCA
HKR203399 ARiS008I07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTACCNCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR203505 ARiS008M17 pGCAP10 NM_021104.1  
GCTCTCGNCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR205221 ARiS013A21 pGCAP10 NM_021104.1  
CTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR205331 ARiS013F11 pGCAP10 NM_021104.1  
TTTTTTTTTTTTTGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGA
HKR205518 ARiS013N06 pGCAP10 NM_021104.1  
CTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR208022 ARiS020A22 pGCAP10 NM_021104.1  
TGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR208050 ARiS020C02 pGCAP10 NM_021104.1  
TGTCTCTCGGCCTTANCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR208072 ARiS020C24 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR208250 ARiS020K10 pGCAP10 NM_021104.1  
TGCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR209286 ARiS023D14 pGCAP10 NM_021104.1  
GCTCTCGNCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR209338 ARiS023F18 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR209357 ARiS023G13 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR209371 ARiS023H03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR209508 ARiS023M20 pGCAP10 NM_021104.1  
TGGCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGG
HKR218005 ARiS045A05 pGCAP10 NM_021104.1  
GGCTCTCGGCCTTAGCGCCNNTNNNNNGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR218129 ARiS045F09 pGCAP10 NM_021104.1  
GTCTCTCNNCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR218198 ARiS045I06 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR218201 ARiS045I09 pGCAP10 NM_021104.1  
CTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR218288 ARiS045L24 pGCAP10 NM_021104.1  
GCTCtcgGccTTGNCGCCNTTTTTTTGGAAANNNCNGCGCCNTGAGAGNCNANTGGAGGA
HKR219725 ARiS049F05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR219860 ARiS049K20 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCCCCNTTTTTTTGGAAACCTCTGCGCCATGAGAGCCNNGTGGAGGA
HKR219875 ARiS049L11 pGCAP10 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR222125 ARiS055F05 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR222141 ARiS055F21 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR222184 ARiS055H16 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR222328 ARiS055N16 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR234159 ARiS085G15 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR234254 ARiS085K14 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR234993 ARiS087I01 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR235011 ARiS087I19 pGCAP10 NM_021104.1  
GCTCTCTCGNCCTTANCNCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR235451 ARiS088K11 pGCAP10 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR238554 ARiS096G10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR243717 ARiS109E21 pGCAP10 NM_021104.1  
GCTCTCNNCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR243916 ARiS109N04 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR247512 ARiS118M24 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR248949 ARiS122G05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR248970 ARiS122H02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR249104 ARiS122M16 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR249142 ARiS122O06 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR264588 ARiS161H20 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR264649 ARiS161K09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR264777 ARiS161P17 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR276450 ARiS191C02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR276697 ARiS191M09 pGCAP10 NM_021104.1  
GCTCTCGNCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR277610 ARiS194A10 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR277693 ARiS194D21 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR277730 ARiS194F10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCNTTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR277754 ARiS194G10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR277805 ARiS194I13 pGCAP10 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR277812 ARiS194I20 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR279295 ARiS198D23 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR320529 RBb01F09 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR321232 RBb03B08 pKA1U5 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTTGCGCCATGAGAGCCAAGTGGAG
HKR322545 RBb06G01 pKA1U5 NM_021104.1  
ATCCTGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGT
HKR322853 RBb07C05 pKA1U5 NM_021104.1  
ATCCTGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGT
HKR323708 RBb09E12 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR323723 RBb09F03 pKA1U5 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR324107 RBb10E11 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR324849 RBb12C01 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR325349 RBb13G05 pKA1U5 NM_021104.1  
GCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAAG
HKR325676 RBb14D04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR326036 RBb15B12 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR326049 RBb15C01 pKA1U5 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR326429 RBb16B05 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR326499 RBb16E03 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR327228 RBb18B04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR327231 RBb18B07 pKA1U5 NM_021104.1  
ATCCTGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGT
HKR327655 RBb19C07 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR328124 RBb20F04 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR328460 RBb21C12 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR328570 RBb21H02 pKA1U5 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR331301 RBb28E05 pGCAP1 NM_021104.1  
TGCTCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTG
HKR332875 RBb32D03 pGCAP1 NM_021104.1  
TTGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR333303 RBb33E07 pGCAP1 NM_021104.1  
AAATGTGCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGG
HKR335326 RBb38F06 pGCAP1 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR335774 RBb39H06 pGCAP1 NM_021104.1  
GGAGACGGAACTTCGCCTTTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCC
HKR336531 RBb41F11 pGCAP1 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR336883 RBb42D11 pGCAP1 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR337374 RBb43H06 pGCAP1 NM_021104.1  
GCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR338974 RBb47H06 pGCAP1 NM_021104.1  
CTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR340170 RBb50H02 pGCAP1 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGGTGGAGGA
HKR340478 RBb51D06 pGCAP1 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAAGAGCCAAGTGGAGG
HKR340530 RBb51F10 pGCAP1 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR341746 RBb54G02 pGCAP1 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR342172 RBb55H04 pGCAP1 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR342411 RBb56A11 pGCAP1 NM_021104.1  
AGCTCTCGGCCTTAGCGCCATTNTNTNTGGAAACCTCTGCGCCATGTAGAGCCAAGTGGA
HKR344546 RBb61G02 pGCAP1 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR344850 RBb62C02 pGCAP1 NM_021104.1  
GCTCTCGGCCTTAGCGCCTTTTTTTGGAACCTCTGCGCCATGAGAGCCAAGTGGAGGAGA
HKR346433 RBb66B09 pGCAP1 NM_021104.1  
TGTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR347280 RBb68D08 pGCAP1 NM_021104.1  
TGGTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGA
HKR348477 RBb71D05 pGCAP1 NM_021104.1  
AGCTCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTG
HKR348553 RBb71G09 pGCAP1 NM_021104.1  
TGGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR360527 RBd01F07 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGGTGAGTGTTTTTTGGTTCCTGCGTTGGGATT
HKR360553 RBd01G09 pGCAP10 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR361635 RBd04B11 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR362156 RBd05G12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR362880 RBd07D08 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR363657 RBd09C09 pGCAP10 NM_021104.1  
GTTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR364029 RBd10B05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR366003 RBd15A03 pGCAP10 NM_021104.1  
GGTAGACGGAACTTCGCCTTTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGC
HKR366025 RBd15B01 pGCAP10 NM_021104.1  
AAGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR366802 RBd17A02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR368108 RBd20E12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGAGCCATTTGTTTGGACACCTCTGCGCCATGACCTCCAAGTGNNGGA
HKR369373 RBd23H05 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR369729 RBd24F09 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGGTGAGC
HKR370146 RBd25G02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR371629 RBd29B05 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR371731 RBd29F11 pGCAP10 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGGTGAGCGG
HKR373681 RBd34D09 pGCAP10 NM_021104.1  
GGAGGGGGTTGCCTTAGCGCCNNTTTTTTGGAAACCTCTGCACCATGAAAGCCAANTGGA
HKR373697 RBd34E01 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR374034 RBd35B10 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR374899 RBd37E03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR374945 RBd37G01 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR375211 RBd38A11 pGCAP10 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR377627 RBd44B03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR378577 RBd46H09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR379609 RBd49A09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR380033 RBd50B09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR380079 RBd50D07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR381370 RBd53H02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCNTNNNAGCCAAGGTGAGCG
HKR386058 RBd65C10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR387304 RBd68E08 pGCAP10 NM_021104.1  
GCTCNCGNNCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR387773 RBd69H05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR388856 RBd72C08 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR390805 RBd77A05 pGCAP10 NM_021104.1  
GAGCGCCATTTTTTTGGGTGAGTGTTTTTTGGTTCCTGCGTTGGGATTCCGTGTACAATC
HKR390858 RBd77C10 pGCAP10 NM_021104.1  
CCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR392027 RBd80B03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR392932 RBd82F12 pGCAP10 NM_021104.1  
GTGCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGG
HKR393236 RBd83B12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR393754 RBd84G10 pGCAP10 NM_021104.1  
TGTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR396946 RBd92G02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGAAAACCTCTGCGCCATGACACCCAAGTGGAGGA
HKR399234 RBd98B10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR402979 RBdS007H11 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR406262 RBdS015K22 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR406263 RBdS015K23 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR408972 RBdS022H04 pGCAP10 NM_021104.1  
GCTCNCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR409137 RBdS022O01 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR416108 RBdS040E12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR416151 RBdS040G07 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR416157 RBdS040G13 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR416338 RBdS040O02 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR420597 RBdS051I05 pGCAP10 NM_021104.1  
GTTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR428004 RBdS070A04 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR430072 RBdS075C24 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR430307 RBdS075M19 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR430345 RBdS075O09 pGCAP10 NM_021104.1  
GCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAAG
HKR432645 RBdS081K05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR433380 RBdS083H12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR433410 RBdS083I18 pGCAP10 NM_021104.1  
ATGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAG
HKR433443 RBdS083K03 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR433549 RBdS083O13 pGCAP10 NM_021104.1  
TGCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR441671 RBdS104C23 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR442024 RBdS105A24 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR442140 RBdS105F20 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR444053 RBdS110C05 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR444083 RBdS110D11 pGCAP10 NM_021104.1  
GTCTCTCGGCCTTAGCNCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR452977 RBdS132H09 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR461758 RBdS154G14 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR474895 RBdS187D23 pGCAP10 NM_021104.1  
GTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGAA
HKR474906 RBdS187E10 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR474932 RBdS187F12 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR474969 RBdS187H01 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA
HKR475020 RBdS187J04 pGCAP10 NM_021104.1  
CTCCGCTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGT
HKR475151 RBdS187O15 pGCAP10 NM_021104.1  
GCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl