Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022O06

Clone ID RBdS022O06
HP ID HP00309
Gene ID 6130
Gene Symbol RPL7A
Protein Name ribosomal protein L7a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000972.2
Length of RefSeq (bp) 890
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.499839
5'-terminal sequence GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
2011.08.28