Prev. |  KEGG KO K02936 > 

RIKEN DNA Bank Human Resource - RPL7A

Gene ID NCBI Gene 6130 |  KEGG hsa:6130
Gene Symbol RPL7A
Protein Name ribosomal protein L7a
Synonyms L7A|SURF3|TRUP
Ortholog resources KEGG ortholog (KEGG orthology K02936) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085740 IRAL014F20 pOTB7 BC005128 -
HGY090345 IRAL025O09 pOTB7 BC021979 -
HGY093466 IRAL033L02 pOTB7 BC023624 -
HGY093527 IRAL033N15 pOTB7 BC023594 -
HGY103230 IRAL058B06 pOTB7 BC073802 -
HGY103409 IRAL058I17 pOTB7 BC071900 -
HGY103423 IRAL058J07 pOTB7 BC071901 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081613 M01C004A13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081661 M01C004C13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081709 M01C004E13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081757 M01C004G13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081805 M01C004I13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081853 M01C004K13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081901 M01C004M13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  
HGE081949 M01C004O13 pDONR221 04-134-2_2-E07 BC023594 NM_000972  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042172 ARe05H04 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGANCGNTTGCCAAGGGAAAGAAGGTGGCT
HKR042507 ARe06E11 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR044433 ARe11B09 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR044859 ARe12C11 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR044946 ARe12G02 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAANTTAAGGCCAAGGGAAAGAAGGTG
HKR045277 ARe13D05 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR045601 ARe14A01 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR046452 ARe16C04 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR046901 ARe17E05 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR047656 ARe19C08 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR055284 ARe38D12 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR057323 ARe43F03 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGACAGATGGCCAAGGGAAAGAAGGTGGCT
HKR058801 ARe47A01 pKA1U5 NM_000972.2  
GCTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAA
HKR058874 ARe47D02 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR059610 ARe49A10 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCANNATGCCGAAANCCNTTNAGGCCAAGGGAAAGAAGGTGG
HKR059676 ARe49D04 pKA1U5 NM_000972.2  
TGGGGCACAGGGCGAGGGCGGCTGCGGCGCAGCTCTGCAGCATGGCGTACCCGGGGCATC
HKR059684 ARe49D12 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGANAGNAGGCCAAGGGAAAGAAGGTGGCT
HKR064859 ARe62C11 pKA1U5 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR069373 ARe73H05 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGCCTTTAAGGCCAAGGGAAAGAAGGTG
HKR070857 ARe77C09 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGANAGNNGGCCAAGGGAAAGAAGGTGGCT
HKR072128 ARe80F08 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR072969 ARe82H01 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR073212 ARe83A12 pKA1U5 NM_000972.2  
GCTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGT
HKR074027 ARe85B03 pKA1U5 NM_000972.2  
ATCCTGCTTTTTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAA
HKR074403 ARe86A03 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR074852 ARe87C04 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR076547 ARe91G03 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR079251 ARe98C03 pKA1U5 NM_000972.2  
TAGAACCAAATCCTTTTAACCATTTTGAATAAATTTAGAGTTTTATAAAAAAAAAAAAAA
HKR079331 ARe98F11 pKA1U5 NM_000972.2  
GGCAGTCTGCAGCATGGCGTACCCGGGGCATCCTGGCGCCGGCGGCGGGTACTACCCAGG
HKR080925 ARf02F05 pKA1U5 NM_000972.2  
GTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTC
HKR162545 ARi06G01 pGCAP10 NM_000972.2  
GCTCCTCCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR164076 ARi10D04 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR164146 ARi10G02 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTG
HKR164453 ARi11C05 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR164832 ARi12B08 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR166859 ARi17C11 pGCAP10 NM_000972.2  
GCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGC
HKR166878 ARi17D06 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR170058 ARi25C10 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR170179 ARi25H11 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR171209 ARi28A09 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR173307 ARi33E11 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR173629 ARi34B05 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR173732 ARi34F12 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR174433 ARi36B09 pGCAP10 NM_000972.2  
GGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCAGCTG
HKR174825 ARi37B01 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR175378 ARi38H10 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCNAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR176036 ARi40B12 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR176435 ARi41B11 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR177258 ARi43C10 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR177347 ARi43G03 pGCAP10 NM_000972.2  
GGTCTGCAGCATGGCGTACCCGGGGCATCCTGGCGCCGGCGGCGGGTACTACCCAGGCGG
HKR178522 ARi46F02 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR180455 ARi51C07 pGCAP10 NM_000972.2  
TGCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTG
HKR181326 ARi53F06 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR182404 ARi56A04 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR182855 ARi57C07 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR183205 ARi58A05 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR183379 ARi58H11 pGCAP10 NM_000972.2  
GCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCC
HKR183697 ARi59E01 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR188407 ARi71A07 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR203297 ARiS008E01 pGCAP10 NM_000972.2  
CGGCCGGCCGATGGGCGGCTGCGGCGCAGTCTGCAGCATGGCGTACCCGGGGCATCCTGG
HKR203480 ARiS008L16 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR205234 ARiS013B10 pGCAP10 NM_000972.2  
TGCTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAA
HKR205389 ARiS013H21 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR205416 ARiS013I24 pGCAP10 NM_000972.2  
CTTGCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGG
HKR205526 ARiS013N14 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR208104 ARiS020E08 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR209395 ARiS023I03 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR218084 ARiS045D12 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR218092 ARiS045D20 pGCAP10 NM_000972.2  
GGGCCCNNCTNNCCNNCCNCCNATCGGGNGNGGGTGCAGGNGCATCGGCCATCACGGGGC
HKR219796 ARiS049I04 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR222046 ARiS055B22 pGCAP10 NM_000972.2  
GTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTC
HKR222231 ARiS055J15 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR234143 ARiS085F23 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR235320 ARiS088E24 pGCAP10 NM_000972.2  
CGGCCGGCCGATGCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGA
HKR235387 ARiS088H19 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR238515 ARiS096E19 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR238541 ARiS096F21 pGCAP10 NM_000972.2  
GCTCTCCTCCCNCCNCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR238606 ARiS096I14 pGCAP10 NM_000972.2  
GCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCC
HKR243646 ARiS109B22 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR243853 ARiS109K13 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR243961 ARiS109P01 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR243969 ARiS109P09 pGCAP10 NM_000972.2  
HKR247335 ARiS118F15 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR247532 ARiS118N20 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR260094 ARiS150D22 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR260145 ARiS150G01 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR260194 ARiS150I02 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR264498 ARiS161E02 pGCAP10 NM_000972.2  
GCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCA
HKR264573 ARiS161H05 pGCAP10 NM_000972.2  
CTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR276662 ARiS191K22 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR277670 ARiS194C22 pGCAP10 NM_000972.2  
CTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAG
HKR277912 ARiS194M24 pGCAP10 NM_000972.2  
CTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR322083 RBb05D11 pKA1U5 NM_000972.2  
GTCTCGTCCTCCCGNCGCCCCNAGATGNCCCANTNGANNNANGGTCANTGGANNCAAAGT
HKR322172 RBb05H04 pKA1U5 NM_000972.2  
GCTTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGATNGGAAAGAAGGCCAAGGGAAAGA
HKR322476 RBb06D04 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR322807 RBb07A07 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR326035 RBb15B11 pKA1U5 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR326408 RBb16A08 pKA1U5 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR329253 RBb23C05 pGCAP1 NM_000972.2  
TGCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTG
HKR333370 RBb33H02 pGCAP1 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR336805 RBb42A05 pGCAP1 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR338507 RBb46E11 pGCAP1 NM_000972.2  
TTGCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR347260 RBb68C12 pGCAP1 NM_000972.2  
AAATGTGTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAA
HKR363775 RBd09H07 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR366084 RBd15D12 pGCAP10 NM_000972.2  
GCTTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGA
HKR367656 RBd19C08 pGCAP10 NM_000972.2  
TGCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCG
HKR368103 RBd20E07 pGCAP10 NM_000972.2  
GGAGTGAGCTGTAGTTCCGTGGCACTATAGCCAGGTTCCGGCTGTATCCGCTGCCATCCT
HKR368155 RBd20G11 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR368836 RBd22B12 pGCAP10 NM_000972.2  
HKR369228 RBd23B04 pGCAP10 NM_000972.2  
GTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAG
HKR369634 RBd24B10 pGCAP10 NM_000972.2  
GCTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGT
HKR376904 RBd42E08 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR376971 RBd42H03 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR377228 RBd43B04 pGCAP10 NM_000972.2  
GGCACAGGGCGAGGGCGGCTGCGGCGCAGTCTGCAGCATGGCGTACCCGGGGCATCCTGG
HKR380060 RBd50C12 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR382951 RBd57G07 pGCAP10 NM_000972.2  
GCTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAG
HKR385700 RBd64E04 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR385770 RBd64H02 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR386149 RBd65G05 pGCAP10 NM_000972.2  
GTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTG
HKR386455 RBd66C07 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR386529 RBd66F09 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR387770 RBd69H02 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR388083 RBd70D11 pGCAP10 NM_000972.2  
GCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCT
HKR394073 RBd85D01 pGCAP10 NM_000972.2  
GTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTG
HKR394805 RBd87A05 pGCAP10 NM_000972.2  
CTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR398945 RBd97G01 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR405482 RBdS013L18 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR405577 RBdS013P17 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR408835 RBdS022B11 pGCAP10 NM_000972.2  
GCTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAG
HKR408978 RBdS022H10 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR409142 RBdS022O06 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR416278 RBdS040L14 pGCAP10 NM_000972.2  
TGTTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGA
HKR420699 RBdS051M11 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR430080 RBdS075D08 pGCAP10 NM_000972.2  
TGCTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGG
HKR432570 RBdS081H02 pGCAP10 NM_000972.2  
GTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGC
HKR432637 RBdS081J21 pGCAP10 NM_000972.2  
GCTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAA
HKR441687 RBdS104D15 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR444255 RBdS110K15 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR444307 RBdS110M19 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR452872 RBdS132C24 pGCAP10 NM_000972.2  
GCTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAG
HKR461615 RBdS154A15 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR461770 RBdS154H02 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR461809 RBdS154I17 pGCAP10 NM_000972.2  
GCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCC
HKR462699 RBdS156M11 pGCAP10 NM_000972.2  
CGGCCGGCCGATGCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGA
HKR470908 RBdS177E12 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR474940 RBdS187F20 pGCAP10 NM_000972.2  
GCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGG
HKR475119 RBdS187N07 pGCAP10 NM_000972.2  
GCTTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl