Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022C14

Clone ID RBdS022C14
HP ID HP00043
Gene ID 6208
Gene Symbol RPS14
Protein Name ribosomal protein S14
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005617.3
Length of RefSeq (bp) 576
Chromosome 5q31-q33
Reference DDBJ accession
UniGene Hs.719080
5'-terminal sequence TCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
2011.08.28