Prev. |  KEGG KO K02955 > 

RIKEN DNA Bank Human Resource - RPS14

Gene ID NCBI Gene 6208 |  KEGG hsa:6208
Gene Symbol RPS14
Protein Name ribosomal protein S14
Synonyms EMTB|S14
Ortholog resources KEGG ortholog (KEGG orthology K02955) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001267 IRAK003C19 pCMV-SPORT6 BC006784 NM_005617 Full
HGX001562 IRAK003P02 pCMV-SPORT6 BC003401 NM_005617 Full
HGX008366 IRAK020P06 pCMV-SPORT6 BC020515 NM_005617 Full
HGY081503 IRAL003M15 pOTB7 BC001126 NM_005617 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019400 W01A048I08 pENTR-TOPO IRAK003P02 BC003401 NM_005617  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041202 ARe03A02 pKA1U5 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR041273 ARe03D01 pKA1U5 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR042809 ARe07A09 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGCTGCAGAAATGGCACCTCGAAAGGGGA
HKR044130 ARe10F10 pKA1U5 NM_005617.3  
ATCCTGCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGG
HKR048899 ARe22E03 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR051780 ARe29H12 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR055300 ARe38E04 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGCTGCAGAAATGGCACCTCGAAAGGGGA
HKR062125 ARe55F05 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGCNGCNTAAATGGCACCTCGAAAGGGGA
HKR066007 ARe65A07 pKA1U5 NM_005617.3  
ACCTGCTCTTTCCGGTGTTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGG
HKR066051 ARe65C03 pKA1U5 NM_005617.3  
TGCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGA
HKR066075 ARe65D03 pKA1U5 NM_005617.3  
TGCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAG
HKR069298 ARe73E02 pKA1U5 NM_005617.3  
TGGGACCCCCGNTCGCTCCGCCCCCTCCCACTCTCTCTTTCCGGTGTGGAGTCTGGAGAC
HKR070002 ARe75A02 pKA1U5 NM_005617.3  
CTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGA
HKR071708 ARe79E12 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR076506 ARe91E10 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGCTGCAGAAATGGCACCTCGAAAGGGGA
HKR077626 ARe94B02 pKA1U5 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR162057 ARi05C09 pGCAP10 NM_005617.3  
GGCGACAATCGGGGGGCATCCTGCGGCGAGGGGACCCTGTGGGGCTTGGGACGAGAGACG
HKR162155 ARi05G11 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR166969 ARi17H01 pGCAP10 NM_005617.3  
GCTTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGA
HKR168084 ARi20D12 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR169304 ARi23E08 pGCAP10 NM_005617.3  
GCTTTCCGGCGTGGAGTCTGGAGACGACGTGCCAAATGAGNNCTCGNAAGGGGAAGGAAA
HKR177683 ARi44D11 pGCAP10 NM_005617.3  
CGGCCGGCCGATGGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAG
HKR179775 ARi49H07 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR182405 ARi56A05 pGCAP10 NM_005617.3  
GCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAA
HKR185234 ARi63B10 pGCAP10 NM_005617.3  
CGGCCGGCCGATGCTCTTTCCGGGGTGGAGTCTGGAGACGACGTGCANAANTGGCACCTC
HKR203317 ARiS008E21 pGCAP10 NM_005617.3  
GTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAG
HKR234096 ARiS085D24 pGCAP10 NM_005617.3  
GGCTCCGCCCCCTCCCACTCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAAT
HKR235026 ARiS087J10 pGCAP10 NM_005617.3  
GGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAA
HKR235210 ARiS088A10 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR235381 ARiS088H13 pGCAP10 NM_005617.3  
CGGCCGGCCGATGCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACC
HKR235423 ARiS088J07 pGCAP10 NM_005617.3  
GGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAA
HKR235505 ARiS088M17 pGCAP10 NM_005617.3  
GGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAA
HKR235551 ARiS088O15 pGCAP10 NM_005617.3  
GCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGA
HKR243738 ARiS109F18 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR247376 ARiS118H08 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR249147 ARiS122O11 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR260340 ARiS150O04 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR264463 ARiS161C15 pGCAP10 NM_005617.3  
GCTCTTTCNTGTGTGGANCNNNGNNNNNACGTGCANAATTGGCACCTCAAANGGGGAAGG
HKR279461 ARiS198K21 pGCAP10 NM_005617.3  
HKR279519 ARiS198N07 pGCAP10 NM_005617.3  
CTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGA
HKR321659 RBb04C11 pKA1U5 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGCTGCAGAAATGGCACCTCGAAAGGGGA
HKR322145 RBb05G01 pKA1U5 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR327779 RBb19H11 pKA1U5 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGCTNCATTNATGGCACCTCGAAAGGGGAAG
HKR328577 RBb21H09 pKA1U5 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGCTNCATAAATGGCACCTCGAAAGGGGAAG
HKR330804 RBb27A04 pGCAP1 NM_005617.3  
TGCTCTTTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGA
HKR341251 RBb53C03 pGCAP1 NM_005617.3  
GGCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGA
HKR342475 RBb56D03 pGCAP1 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR345658 RBb64C10 pGCAP1 NM_005617.3  
GCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAA
HKR348922 RBb72F02 pGCAP1 NM_005617.3  
HKR362124 RBd05F04 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR362974 RBd07H06 pGCAP10 NM_005617.3  
GCTTTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR364084 RBd10D12 pGCAP10 NM_005617.3  
GTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAG
HKR366575 RBd16H07 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR367723 RBd19F03 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR370906 RBd27E10 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR373329 RBd33F09 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR380579 RBd51H11 pGCAP10 NM_005617.3  
GTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGA
HKR386899 RBd67E03 pGCAP10 NM_005617.3  
GGCCCCCTCCCACTCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCAC
HKR394809 RBd87A09 pGCAP10 NM_005617.3  
GTCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGA
HKR396556 RBd91G12 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR397323 RBd93F03 pGCAP10 NM_005617.3  
TGGTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGA
HKR398078 RBd95D06 pGCAP10 NM_005617.3  
GTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAG
HKR398876 RBd97D04 pGCAP10 NM_005617.3  
GCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR399205 RBd98A05 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR405431 RBdS013J15 pGCAP10 NM_005617.3  
GCTCNCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR408862 RBdS022C14 pGCAP10 NM_005617.3  
TCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGG
HKR428365 RBdS070P05 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR432464 RBdS081C16 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR433398 RBdS083I06 pGCAP10 NM_005617.3  
TTGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAAGAACAGGTC
HKR442248 RBdS105K08 pGCAP10 NM_005617.3  
GAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAAGAAC
HKR453000 RBdS132I08 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR453042 RBdS132K02 pGCAP10 NM_005617.3  
TGCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAG
HKR453152 RBdS132O16 pGCAP10 NM_005617.3  
GCTCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAA
HKR461818 RBdS154J02 pGCAP10 NM_005617.3  
GGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAA
HKR461878 RBdS154L14 pGCAP10 NM_005617.3  
CGGCCGGCCGATGCTCTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTC
HKR474873 RBdS187D01 pGCAP10 NM_005617.3  
TGCTCTTTTTCCGGTGTGGAGTCTGGAGACGACGTGCAGAAATGGCACCTCGAAAGGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl