Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022B18

Clone ID RBdS022B18
HP ID HP07916
Gene ID 6102
Gene Symbol RP2
Protein Name retinitis pigmentosa 2 (X-linked recessive)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006915.2
Length of RefSeq (bp) 3831
Chromosome Xp11.4-p11.21
Reference DDBJ accession
UniGene Hs.44766
5'-terminal sequence GGGGCAAACTAAGGCTGCGGACCGTTGGGCGGTTCCGCGGGGCGTTGTCCGGAGAGCTGC
2011.08.28