Prev. |  KEGG KO K18272 > 

RIKEN DNA Bank Human Resource - RP2

Gene ID NCBI Gene 6102 |  KEGG hsa:6102
Gene Symbol RP2
Protein Name RP2, ARL3 GTPase activating protein
Synonyms DELXp11.3|NM23-H10|NME10|TBCCD2|XRP2
Ortholog resources KEGG ortholog (KEGG orthology K18272) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035676 IRAK089D04 pCMV-SPORT6 BC043348 NM_006915 Full/var
HGX046009 IRAK115A09 pCMV-SPORT6 BC053530 NM_006915 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR408842 RBdS022B18 pGCAP10 NM_006915.2  
GGGGCAAACTAAGGCTGCGGACCGTTGGGCGGTTCCGCGGGGCGTTGTCCGGAGAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl