Prev. |  KEGG KO K18272 > 

RIKEN DNA Bank Human Resource - RP2

Gene ID NCBI Gene 6102 |  KEGG hsa:6102
Gene Symbol RP2
Protein Name RP2 activator of ARL3 GTPase
Synonyms DELXp11.3|NM23-H10|NME10|TBCCD2|XRP2
Ortholog resource in our bank

  RP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035676 IRAK089D04 pCMV-SPORT6 BC043348 NM_006915 Full/var
HGX046009 IRAK115A09 pCMV-SPORT6 BC053530 NM_006915 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR408842 RBdS022B18 pGCAP10 NM_006915.2  
GGGGCAAACTAAGGCTGCGGACCGTTGGGCGGTTCCGCGGGGCGTTGTCCGGAGAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl