Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015J24

Clone ID RBdS015J24
HP ID HP00318
Gene ID 23521
Gene Symbol RPL13A
Protein Name ribosomal protein L13a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_012423.2
Length of RefSeq (bp) 1142
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.523185
5'-terminal sequence GCTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
2011.08.28