Prev. |  KEGG KO K02872 > 

RIKEN DNA Bank Human Resource - RPL13A

Gene ID NCBI Gene 23521 |  KEGG hsa:23521
Gene Symbol RPL13A
Protein Name ribosomal protein L13a
Synonyms L13A|TSTA1
Ortholog resources KEGG ortholog (KEGG orthology K02872) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056304 IRAK140M16 pCMV-SPORT6 BC065236 NM_012423 Full
HGY080626 IRAL001J10 pOTB7 BC000514 NM_012423 Full
HGY080934 IRAL002F14 pOTB7 BC001675 NM_012423 Full
HGY084275 IRAL010L11 pOTB7 BC001836 NM_012423 Full
HGY084480 IRAL011D08 pOTB7 BC004900 NM_012423 Partial
HGY100136 IRAL050F16 pOTB7 BC062537 NM_012423 Full
HGY103131 IRAL057N19 pDNR-LIB BC070223 NM_012423 Full
HGY103387 IRAL058H19 pOTB7 BC071929 NM_012423 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042858 ARe07C10 pKA1U5 NM_012423.2  
GCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR048007 ARe20A07 pKA1U5 NM_012423.2  
GCTCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR048180 ARe20H12 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR048926 ARe22F06 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR054923 ARe37F03 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR054953 ARe37G09 pKA1U5 NM_012423.2  
TGTTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR056126 ARe40F06 pKA1U5 NM_012423.2  
ATCCTGGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATG
HKR058574 ARe46H06 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR065378 ARe63H10 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR066929 ARe67F09 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGANNCTTATNGATCCTGGTGCTTGATGGTCG
HKR068173 ARe70H05 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCANGATCCTGGTGCTTGATGGTCGA
HKR073355 ARe83G11 pKA1U5 NM_012423.2  
TGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR073602 ARe84A02 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR075379 ARe88H11 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR076880 ARe92D08 pKA1U5 NM_012423.2  
GCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR077202 ARe93A02 pKA1U5 NM_012423.2  
TTGCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR077774 ARe94H06 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR078555 ARe96G11 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR079301 ARe98E05 pKA1U5 NM_012423.2  
GCTTTTTCCAAGCGGCTGCCNAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR081684 ARf04D12 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR081780 ARf04H12 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR161705 ARi04E09 pGCAP10 NM_012423.2  
GCTTTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGT
HKR163252 ARi08C04 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR163777 ARi09H09 pGCAP10 NM_012423.2  
TGCTTTTCCNAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR164405 ARi11A05 pGCAP10 NM_012423.2  
GCTTTTTCCNAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR165348 ARi13G04 pGCAP10 NM_012423.2  
AGGGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR165676 ARi14D04 pGCAP10 NM_012423.2  
GCTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR165683 ARi14D11 pGCAP10 NM_012423.2  
TGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR168176 ARi20H08 pGCAP10 NM_012423.2  
GCCTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR171210 ARi28A10 pGCAP10 NM_012423.2  
GCTTTTCCANGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCNAG
HKR171673 ARi29D01 pGCAP10 NM_012423.2  
GCTTCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGT
HKR173209 ARi33A09 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR175304 ARi38E08 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR176101 ARi40E05 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR178802 ARi47A02 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR179612 ARi49A12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR180029 ARi50B05 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR181699 ARi54E03 pGCAP10 NM_012423.2  
GCTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR182174 ARi55H06 pGCAP10 NM_012423.2  
GCTTTTCCAGCCGGCTGCCCCGANTNCGGATCGTGTTGGTCCTGGCGCCCGATGACCGAG
HKR182898 ARi57E02 pGCAP10 NM_012423.2  
GGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGGCCATCTCCTGGGCCGCC
HKR183228 ARi58B04 pGCAP10 NM_012423.2  
GCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR184106 ARi60E10 pGCAP10 NM_012423.2  
GCTCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR185328 ARi63F08 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR185378 ARi63H10 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR186836 ARi67B12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR188503 ARi71E07 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR203466 ARiS008L02 pGCAP10 NM_012423.2  
ACGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR208195 ARiS020I03 pGCAP10 NM_012423.2  
TGGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR208288 ARiS020L24 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR218372 ARiS045P12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR219753 ARiS049G09 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR234380 ARiS085P20 pGCAP10 NM_012423.2  
CGGCCGGCCGATGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGC
HKR235579 ARiS088P19 pGCAP10 NM_012423.2  
TGCTTTTTTCCAAGCGGCNGCCGAANNNGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR264542 ARiS161F22 pGCAP10 NM_012423.2  
GCTTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR276449 ARiS191C01 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR276501 ARiS191E05 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR279239 ARiS198B15 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCNGCCGAANNNGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR322174 RBb05H06 pKA1U5 NM_012423.2  
ATCCTGTGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGAT
HKR322832 RBb07B08 pKA1U5 NM_012423.2  
GCTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR323324 RBb08F04 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR325331 RBb13F11 pKA1U5 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGATCCTGGTGCTTGATGGTCGA
HKR330102 RBb25E06 pGCAP1 NM_012423.2  
GCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR332056 RBb30C08 pGCAP1 NM_012423.2  
AAATGTGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATG
HKR333604 RBb34A04 pGCAP1 NM_012423.2  
TGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR336548 RBb41G04 pGCAP1 NM_012423.2  
GCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR338951 RBb47G07 pGCAP1 NM_012423.2  
GCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR341772 RBb54H04 pGCAP1 NM_012423.2  
GCTTTTCCAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR343235 RBb58B11 pGCAP1 NM_012423.2  
TTGCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR347632 RBb69B08 pGCAP1 NM_012423.2  
CTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGG
HKR348852 RBb72C04 pGCAP1 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR362169 RBd05H01 pGCAP10 NM_012423.2  
GCTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR365630 RBd14B06 pGCAP10 NM_012423.2  
GCTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR366106 RBd15E10 pGCAP10 NM_012423.2  
TGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR368556 RBd21G12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR369321 RBd23F01 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR377369 RBd43H01 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR383278 RBd58D06 pGCAP10 NM_012423.2  
GCTTTTCCNAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGNTGCTTGATGGTCGAG
HKR383653 RBd59C05 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR383728 RBd59F08 pGCAP10 NM_012423.2  
TTTTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR386171 RBd65H03 pGCAP10 NM_012423.2  
GCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR389330 RBd73F10 pGCAP10 NM_012423.2  
GCTTTTCCNNNCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR390060 RBd75C12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR406240 RBdS015J24 pGCAP10 NM_012423.2  
GCTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR406316 RBdS015N04 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR406324 RBdS015N12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR408817 RBdS022A17 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR416275 RBdS040L11 pGCAP10 NM_012423.2  
GCTCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR428060 RBdS070C12 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR442033 RBdS105B09 pGCAP10 NM_012423.2  
AGGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCG
HKR442068 RBdS105C20 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTCCTGGTGCTTGATGGTCGAGGCCATC
HKR444230 RBdS110J14 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR452955 RBdS132G11 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR462545 RBdS156G01 pGCAP10 NM_012423.2  
GCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAG
HKR462678 RBdS156L14 pGCAP10 NM_012423.2  
CGCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGA
HKR471051 RBdS177K11 pGCAP10 NM_012423.2  
GCTTTTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC
HKR471136 RBdS177N24 pGCAP10 NM_012423.2  
CCTCCTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl