Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015F10

Clone ID RBdS015F10
HP ID HP00468
Gene ID 6155
Gene Symbol RPL27
Protein Name ribosomal protein L27
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000988.3
Length of RefSeq (bp) 514
Chromosome 17q21.1-q21.2
Reference DDBJ accession
UniGene Hs.514196
5'-terminal sequence GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
2011.08.28