Prev. |  KEGG KO K02901 > 

RIKEN DNA Bank Human Resource - RPL27

Gene ID NCBI Gene 6155 |  KEGG hsa:6155
Gene Symbol RPL27
Protein Name ribosomal protein L27
Synonyms DBA16|L27
Ortholog resources KEGG ortholog (KEGG orthology K02901) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001494 IRAK003M06 pCMV-SPORT6 BC021886 NM_000988 Partial
HGY081584 IRAL003P24 pOTB7 BC001700 NM_000988 Full
HGY081742 IRAL004F22 pOTB7 BC002588 NM_000988 Full
HGY089009 IRAL022I17 pOTB7 BC007273 NM_000988 Full
HGY090851 IRAL027C03 pOTB7 BC010026 NM_000988 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040475 ARe01D03 pKA1U5 NM_000988.3  
GCCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR042075 ARe05D03 pKA1U5 NM_000988.3  
ATCCTGTTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATG
HKR048105 ARe20E09 pKA1U5 NM_000988.3  
TTGCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCAT
HKR059660 ARe49C12 pKA1U5 NM_000988.3  
CCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGA
HKR062432 ARe56B08 pKA1U5 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCCANNTGGGCAAGTTCATGAAACCTGGG
HKR064549 ARe61G05 pKA1U5 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCNAAATGGGCAAGTTCATGAAACCTGGG
HKR064829 ARe62B05 pKA1U5 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR068859 ARe72C11 pKA1U5 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGATATGGGCAAGTTCATGAAACCTGGG
HKR068946 ARe72G02 pKA1U5 NM_000988.3  
GTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCT
HKR070556 ARe76G12 pKA1U5 NM_000988.3  
CCTTTTTGCTGTAGGCCCGGGATGGTTGCTGCCCCNTTGGGCAAGTTCATGAAACCTGGG
HKR071724 ARe79F04 pKA1U5 NM_000988.3  
ATCCTGGTACTTTTTTTTTTTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCA
HKR074433 ARe86B09 pKA1U5 NM_000988.3  
GAGTGTCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTT
HKR074553 ARe86G09 pKA1U5 NM_000988.3  
TGTANTCCTTCTTTCCTTTTTGCTGTAAGCCCGGGATGGNTGCTGCCGAAAATGGGCAAN
HKR079306 ARe98E10 pKA1U5 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR161606 ARi04A06 pGCAP10 NM_000988.3  
GCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGA
HKR165230 ARi13B06 pGCAP10 NM_000988.3  
TTAAGCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCT
HKR166409 ARi16A09 pGCAP10 NM_000988.3  
GTGTGGNGAGCCCGGGTGGNNGGTGGCGGCTGCGGGAGNNCNTTNGGCNGNNAAGGAGGT
HKR166410 ARi16A10 pGCAP10 NM_000988.3  
GGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGAAGGTGG
HKR166880 ARi17D08 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR169632 ARi24B08 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR172802 ARi32A02 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR172808 ARi32A08 pGCAP10 NM_000988.3  
GAGTGTCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTT
HKR173300 ARi33E04 pGCAP10 NM_000988.3  
GACTCCTCACCGGGGTGAAAGGTTAGCGGAAGTGTCCTTCTTTCCTTTTTGCTGTAGGCC
HKR174860 ARi37C12 pGCAP10 NM_000988.3  
GCCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR184108 ARi60E12 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR186921 ARi67F01 pGCAP10 NM_000988.3  
GGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGAAGGTGGTGC
HKR187631 ARi69B07 pGCAP10 NM_000988.3  
GCCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR203528 ARiS008N16 pGCAP10 NM_000988.3  
GTTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACC
HKR205350 ARiS013G06 pGCAP10 NM_000988.3  
ACCTTTTTGCTGTANGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR218030 ARiS045B06 pGCAP10 NM_000988.3  
GTTTCCTTTTTGCTGTNGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCT
HKR218345 ARiS045O09 pGCAP10 NM_000988.3  
CCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCNAAATGGGCAAGTTCATGAAACCTGGG
HKR247554 ARiS118O18 pGCAP10 NM_000988.3  
GCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGA
HKR276594 ARiS191I02 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR276682 ARiS191L18 pGCAP10 NM_000988.3  
TGCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR276716 ARiS191N04 pGCAP10 NM_000988.3  
GCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGA
HKR279445 ARiS198K05 pGCAP10 NM_000988.3  
GGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGAAGGTGG
HKR321327 RBb03F07 pKA1U5 NM_000988.3  
GCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCNGNTNGAAATGGGCAAGTTCATGAAAC
HKR321330 RBb03F10 pKA1U5 NM_000988.3  
AGCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR322104 RBb05E08 pKA1U5 NM_000988.3  
GGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGAAGGTGGTGC
HKR322829 RBb07B05 pKA1U5 NM_000988.3  
AGCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR328169 RBb20H01 pKA1U5 NM_000988.3  
GCCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGG
HKR328508 RBb21E12 pKA1U5 NM_000988.3  
GCCTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACC
HKR344126 RBb60F06 pGCAP1 NM_000988.3  
GCTTTTTTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACC
HKR360973 RBd02H05 pGCAP10 NM_000988.3  
GCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACC
HKR361705 RBd04E09 pGCAP10 NM_000988.3  
GGTCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCAT
HKR366547 RBd16G03 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR366810 RBd17A10 pGCAP10 NM_000988.3  
GAAGTGTCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGT
HKR371780 RBd29H12 pGCAP10 NM_000988.3  
GCCTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACC
HKR373373 RBd33H05 pGCAP10 NM_000988.3  
GTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR380155 RBd50G11 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR382499 RBd56E03 pGCAP10 NM_000988.3  
TTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCANGTTCATGAAACCTGG
HKR382577 RBd56H09 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR384481 RBd61D09 pGCAP10 NM_000988.3  
GCTTTTTTTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAAC
HKR385632 RBd64B08 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR385656 RBd64C08 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR386035 RBd65B11 pGCAP10 NM_000988.3  
CGGCCGGCCGATGGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAAC
HKR386059 RBd65C11 pGCAP10 NM_000988.3  
CGGCCGGCCGATGGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAAC
HKR386503 RBd66E07 pGCAP10 NM_000988.3  
GTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCT
HKR388177 RBd70H09 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR393776 RBd84H08 pGCAP10 NM_000988.3  
GCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAA
HKR398523 RBd96F03 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR399755 RBd99G11 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR399772 RBd99H04 pGCAP10 NM_000988.3  
GCCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAAC
HKR405676 RBdS014D04 pGCAP10 NM_000988.3  
GCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACC
HKR406130 RBdS015F10 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR408923 RBdS022F03 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR420735 RBdS051N23 pGCAP10 NM_000988.3  
CGGCCGGCCGATGCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTC
HKR428145 RBdS070G01 pGCAP10 NM_000988.3  
GGCGTTTTGCTGTNNGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR430044 RBdS075B20 pGCAP10 NM_000988.3  
GCTTTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAA
HKR430221 RBdS075J05 pGCAP10 NM_000988.3  
GGAAGTGTCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAG
HKR441952 RBdS104O16 pGCAP10 NM_000988.3  
GAGCGGAAGTGTCCTTCTTTCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGG
HKR444226 RBdS110J10 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR462407 RBdS156A07 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG
HKR470880 RBdS177D08 pGCAP10 NM_000988.3  
GGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGGAAGGTGG
HKR474805 RBdS187A05 pGCAP10 NM_000988.3  
GCCTTTTTGCTGTAGGCCCGGGTGGTTGCTGCCGAAATGGGCAAGTTCATGAAACCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl