Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014N10

Clone ID RBdS014N10
HP ID HP02295
Gene ID 6117
Gene Symbol RPA1
Protein Name replication protein A1, 70kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002945.3
Length of RefSeq (bp) 4345
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.461925
5'-terminal sequence GGCGCGCAACTTCTCGGGCCAATAACTGCGCAGCGCGCGGGACCCGGGTGGGGAAGCTGG
2011.08.28