Prev. |  KEGG KO K07466 > 

RIKEN DNA Bank Human Resource - RPA1

Gene ID NCBI Gene 6117 |  KEGG hsa:6117
Gene Symbol RPA1
Protein Name replication protein A1
Synonyms HSSB|MST075|REPA1|RF-A|RP-A|RPA70
Featured content DNA repair (human)
Ortholog resource in our bank

  RPA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009022 IRAK022J06 pCMV-SPORT6 BC018126 NM_002945

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008194 W01A020I02 pENTR-TOPO IRAK022J06 BC018126 NM_002945 done
HGE008200 W01A020I08 pENTR-TOPO IRAK022J06 BC018126 NM_002945 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074409 ARe86A09 pKA1U5 NM_002945.3  
GGCACGTCGGGGGCGGGAGCGGTGCGCGCAACTTCTCGGGCCAATAACTGCGCAGCGCGC
HKR171211 ARi28A11 pGCAP10 NM_002945.3  
GACTGCGCAGCGCGCGGGACCCGGGTGGGGAAGCTGGAGCTGTTGCGGGGTCCGCGGGGA
HKR203561 ARiS008P01 pGCAP10 NM_002945.3  
GGGGGAAGCTGGAGCTGTTGCGGGGTCCGCGGGGAAGTCTTGGCGGTGGAGCCATGGTCG
HKR243820 ARiS109J04 pGCAP10 NM_002945.3  
GGCGCAGCGCGCGGGACCCGGGTGGGGAAGCTGGAGCTGTTGCGGGGTCCGCGGGGAAGT
HKR380946 RBd52G02 pGCAP10 NM_002945.3  
GGGGCGGGAGCGGTGCGCGCAACTTCTCGGGCCAATAACTGCGCAGCGCGCGGGACCCGG
HKR405922 RBdS014N10 pGCAP10 NM_002945.3  
GGCGCGCAACTTCTCGGGCCAATAACTGCGCAGCGCGCGGGACCCGGGTGGGGAAGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl