Prev. |  Human A to Z list >  A >  ATL2 > 

RBd93H10 - NRCD Human cDNA Clone

Catalog Number HKR397378
Clone Name RBd93H10
Clone info. Plasmid clone of human ATL2 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GACAAGATGGCGGAGGGGGACGAGGCAGCGCGAGGGCAGCAACCGCACCAGGGGCTGTGG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_022374.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) ATL2 (NCBI Gene 64225)  other clone of ATL2 in our bank
Synonyms ARL3IP2|ARL6IP2|aip-2|atlastin2
Protein Name atlastin GTPase 2
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR397378 RBd93H10 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd93H10 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR397378).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBd93H10a.seq   RBd93H10c.seq RBd93H10z.seq RBd93H10.pdf

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl