Prev. |  KEGG KO K17339 > 

RIKEN DNA Bank Human Resource - ATL2

Gene ID NCBI Gene 64225 |  KEGG hsa:64225
Gene Symbol ATL2
Protein Name atlastin GTPase 2
Synonyms ARL3IP2|ARL6IP2|aip-2|atlastin2
Ortholog resource in our bank

  ATL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001386 IRAK003H18 pCMV-SPORT6 BC039050 NM_022374
HGY099055 IRAL047K15 pOTB7 BC053508 NM_022374 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR397378 RBd93H10 pGCAP10 NM_022374.2 No cds done
GACAAGATGGCGGAGGGGGACGAGGCAGCGCGAGGGCAGCAACCGCACCAGGGGCTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl