RBd91D02 - NRCD Human cDNA Clone

Catalog Number HKR396474 Clone Name RBd91D02 Clone info. Plasmid clone of human RCOR2 cDNA with SV40 promoter Vector Click for information pGCAP10 5'-terminal sequence(1) GACTACTTCCCTGCCAGCAGCTTCATTGTGTGCGCGAGGAGCGAGCGGCGGCGGAGAGCG Sequence, submitted(2) AB593132 [link]   Sequence, refered NM_173587.3 (NCBI RefSeq mRNA) Gene Symbol and ID(3)  (NCBI Gene 283248)  other clone of in our bank Protein Name

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2021.01.19