Prev. | 

RIKEN DNA Bank Human Resource - RCOR2

Gene ID NCBI Gene 283248 |  KEGG hsa:283248
Gene Symbol RCOR2
Protein Name REST corepressor 2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004930 IRAK012F10 pCMV-SPORT6 BC010608 NM_173587 Partial/var
HGY093460 IRAL033K20 pOTB7 BC023587 NM_173587

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR396474 RBd91D02 pGCAP10 NM_173587.3 full/var done
GACTACTTCCCTGCCAGCAGCTTCATTGTGTGCGCGAGGAGCGAGCGGCGGCGGAGAGCG
HKR391683 RBd79D11 pGCAP10 NM_173587.3  
GGCCANNAGNTTCATTGTGTGCGCGAGGAGCGAGCGGCGGCGGAGAGCGGGCGAGCAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl