Prev. |  Human A to Z list >  F >  FAM78B > 

RBd90F11 - NRCD Human cDNA Clone

Catalog Number HKR396131
Clone Name RBd90F11
Clone info. Plasmid clone of human FAM78B cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) TGAGCCGTGGTGCAGAGGTTCATGCAGCGGCGGCGGCGGCGGCGGCTGCTGCTGCTGCCG
Sequence, submitted(3) AB593134 [link]
Note match AB593134.1 (1-3984), CDS:full
 
Sequence, refered NM_001017961.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) FAM78B (NCBI Gene 149297)  other clone of FAM78B in our bank
Synonyms -
Protein Name family with sequence similarity 78 member B
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR396131 RBd90F11 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd90F11 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR396131).

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBd90F11a.seq   RBd90F11c.seq RBd90F11z.seq RBd90F11.pdf

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl