Prev. | 

RIKEN DNA Bank Human Resource - FAM78B

Gene ID NCBI Gene 149297 |  KEGG hsa:149297
Gene Symbol FAM78B
Protein Name family with sequence similarity 78 member B
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR396131 RBd90F11 pGCAP10 NM_001017961.3 done
TGAGCCGTGGTGCAGAGGTTCATGCAGCGGCGGCGGCGGCGGCGGCTGCTGCTGCTGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl